Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp02

Orthogroup ID

OG0015714

Physical Location & Seq

Genomic Coordinates Forward (+)

25299402 .. 25299985

Gene Structure 584 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.2G226800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

ATGCAAAGCCAGGCGCAAAGCCCTGCAAAGAAACAAGAGACGAGAACAAGCATACCTTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTGGGCCAATGGCCCACACGATATTAAATTAATTTCTTTAGGGGGAGGGCCCACTACGGTAGCTTGCTACTGGGGTTCTCGCGCGTCGCCCAAGCGTTGCACTATTGCATGGGCCTGGCGCACCCCACCAAATCTAGTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

87

Amino Acids

9.41

Weight (kDa)

10.19

Isoelectric Point (pI)

58.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015714)

Species	Orthologous Gene IDs
prunus_persica	Prupe.1G098500_v2.0.a1 Prupe.1G113700_v2.0.a1 Prupe.1G117400_v2.0.a1 Prupe.1G135800_v2.0.a1 Prupe.1G136000_v2.0.a1 Prupe.1G136100_v2.0.a1 Prupe.1G136200_v2.0.a1 Prupe.1G232200_v2.0.a1 Prupe.1G384200_v2.0.a1 Prupe.2G064500_v2.0.a1 Prupe.2G226800_v2.0.a1 Prupe.6G338200_v2.0.a1 Prupe.8G172200_v2.0.a1
pyrus_communis	pycom04g19430 pycom16g14190
rosa_laevigata	RLG00000025384

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	2 cut(s)	201, 203
AjnI	CCWGG	2 cut(s)	9, 233
AluBI	AGCT	1 cut(s)	182
AluI	AGCT	1 cut(s)	182
Alw26I	GTCTC	1 cut(s)	32
AoxI	GGCC	5 cut(s)	63, 123, 130, 167, 231
ApaI	GGGCCC	1 cut(s)	171
AseI	ATTAAT	1 cut(s)	149
AspLEI	GCGC	3 cut(s)	16, 203, 240
AspS9I	GGNCC	5 cut(s)	123, 131, 167, 168, 231
BaeGI	GKGCMC	1 cut(s)	171
BanII	GRGCYC	1 cut(s)	171
BciT130I	CCWGG	2 cut(s)	11, 235
BcoDI	GTCTC	1 cut(s)	32
BfaI	CTAG	1 cut(s)	254
Bme1390I	CCNGG	2 cut(s)	11, 235
BmgT120I	GGNCC	5 cut(s)	123, 131, 167, 168, 231
BmiI	GGNNCC	1 cut(s)	169
BmrFI	CCNGG	2 cut(s)	11, 235
BmrI	ACTGGG	1 cut(s)	199
BmuI	ACTGGG	1 cut(s)	199
BsaAI	YACGTR	1 cut(s)	120
Bse1I	ACTGG	1 cut(s)	194
BseBI	CCWGG	2 cut(s)	11, 235
BseNI	ACTGG	1 cut(s)	194
BseSI	GKGCMC	1 cut(s)	171
Bsh1236I	CGCG	2 cut(s)	201, 203
BshFI	GGCC	5 cut(s)	65, 125, 132, 169, 233
BsmAI	GTCTC	1 cut(s)	32
BsmBI	CGTCTC	1 cut(s)	32
BsnI	GGCC	5 cut(s)	65, 125, 132, 169, 233
Bsp120I	GGGCCC	1 cut(s)	167
Bsp1286I	GDGCHC	1 cut(s)	171
Bsp143I	GATC	1 cut(s)	77
BspANI	GGCC	5 cut(s)	65, 125, 132, 169, 233
BspFNI	CGCG	2 cut(s)	201, 203
BspLI	GGNNCC	1 cut(s)	169
BsrI	ACTGG	1 cut(s)	194
BssMI	GATC	1 cut(s)	77
Bst2UI	CCWGG	2 cut(s)	11, 235
Bst4CI	ACNGT	1 cut(s)	178
BstBAI	YACGTR	1 cut(s)	120
BstC8I	GCNNGC	1 cut(s)	184
BstDEI	CTNAG	1 cut(s)	74
BstFNI	CGCG	2 cut(s)	201, 203
BstHHI	GCGC	3 cut(s)	16, 203, 240
BstKTI	GATC	1 cut(s)	80
BstMAI	GTCTC	1 cut(s)	32
BstMBI	GATC	1 cut(s)	77
BstNI	CCWGG	2 cut(s)	11, 235
BstSCI	CCNGG	2 cut(s)	9, 233
BstSLI	GKGCMC	1 cut(s)	171
BstUI	CGCG	2 cut(s)	201, 203
BsuRI	GGCC	5 cut(s)	65, 125, 132, 169, 233
Cac8I	GCNNGC	1 cut(s)	184
CfoI	GCGC	3 cut(s)	16, 203, 240
Cfr13I	GGNCC	5 cut(s)	123, 131, 167, 168, 231
CseI	GACGC	1 cut(s)	192
CviAII	CATG	1 cut(s)	228
CviJI	RGCY	9 cut(s)	9, 21, 65, 73, 125, 132, 169, 182, 233
CviKI_1	RGCY	9 cut(s)	9, 21, 65, 73, 125, 132, 169, 182, 233
DdeI	CTNAG	1 cut(s)	74
DpnI	GATC	1 cut(s)	79
DpnII	GATC	1 cut(s)	77
Eco24I	GRGCYC	1 cut(s)	171
EcoO109I	RGGNCCY	1 cut(s)	167
EcoRII	CCWGG	2 cut(s)	9, 233
EcoT38I	GRGCYC	1 cut(s)	171
Esp3I	CGTCTC	1 cut(s)	32
FaeI	CATG	1 cut(s)	231
FaiI	YATR	2 cut(s)	53, 229
FalI	AAGNNNNNCTT	2 cut(s)	40, 72
FatI	CATG	1 cut(s)	227
FriOI	GRGCYC	1 cut(s)	171
FspBI	CTAG	1 cut(s)	254
GlaI	GCGC	3 cut(s)	15, 202, 239
HaeIII	GGCC	5 cut(s)	65, 125, 132, 169, 233
HgaI	GACGC	1 cut(s)	192
HhaI	GCGC	3 cut(s)	16, 203, 240
Hin1II	CATG	1 cut(s)	231
Hin6I	GCGC	3 cut(s)	14, 201, 238
HinP1I	GCGC	3 cut(s)	14, 201, 238
Hpy188I	TCNGA	1 cut(s)	115
Hpy99I	CGWCG	1 cut(s)	208
HpyCH4III	ACNGT	1 cut(s)	178
HpyCH4IV	ACGT	1 cut(s)	119
HpyCH4V	TGCA	4 cut(s)	4, 26, 219, 227
HpyF3I	CTNAG	1 cut(s)	74
HpySE526I	ACGT	1 cut(s)	119
Hsp92II	CATG	1 cut(s)	231
HspAI	GCGC	3 cut(s)	14, 201, 238
Kzo9I	GATC	1 cut(s)	77
LpnPI	CCDG	5 cut(s)	23, 36, 175, 220, 247
MaeI	CTAG	1 cut(s)	254
MaeII	ACGT	1 cut(s)	119
MalI	GATC	1 cut(s)	79
MboI	GATC	1 cut(s)	77
MhlI	GDGCHC	1 cut(s)	171
MluCI	AATT	2 cut(s)	146, 150
MnlI	CCTC	1 cut(s)	158
MseI	TTAA	4 cut(s)	107, 144, 149, 259
MspR9I	CCNGG	2 cut(s)	11, 235
MvaI	CCWGG	2 cut(s)	11, 235
MvnI	CGCG	2 cut(s)	201, 203
NdeII	GATC	1 cut(s)	77
NlaIII	CATG	1 cut(s)	231
NlaIV	GGNNCC	1 cut(s)	169
NmeAIII	GCCGAG	1 cut(s)	41
Ppu21I	YACGTR	1 cut(s)	120
PshBI	ATTAAT	1 cut(s)	149
Psp6I	CCWGG	2 cut(s)	9, 233
PspGI	CCWGG	2 cut(s)	9, 233
PspN4I	GGNNCC	1 cut(s)	169
PspOMI	GGGCCC	1 cut(s)	167
PspPI	GGNCC	5 cut(s)	123, 131, 167, 168, 231
PsrI	GAACNNNNNNTAC	2 cut(s)	78, 110
SaqAI	TTAA	4 cut(s)	107, 144, 149, 259
Sau3AI	GATC	1 cut(s)	77
Sau96I	GGNCC	5 cut(s)	123, 131, 167, 168, 231
ScrFI	CCNGG	2 cut(s)	11, 235
SduI	GDGCHC	1 cut(s)	171
SetI	ASST	3 cut(s)	58, 122, 184
Sse9I	AATT	2 cut(s)	146, 150
SspMI	CTAG	1 cut(s)	254
StyD4I	CCNGG	2 cut(s)	9, 233
TaaI	ACNGT	1 cut(s)	178
TaiI	ACGT	1 cut(s)	122
TasI	AATT	2 cut(s)	146, 150
Tru1I	TTAA	4 cut(s)	107, 144, 149, 259
Tru9I	TTAA	4 cut(s)	107, 144, 149, 259
VspI	ATTAAT	1 cut(s)	149
XspI	CTAG	1 cut(s)	254

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.