Prupe.1G136000_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
10696656 .. 10696877
222 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G136000.1

Sequence Viewer

Length: 222 bp
ATGAAGATAAGCATACCTTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTGGGCGAATGGCTCGCATGATATTAAATTAATTTATTTAGGAGGAGGTTCCACCATAATAGCTTGCTATTGGGGCTCTCAAGTGTCGCCCAAGCATTGCAACATTGCATGGGCTTGGCACACTCCACCAAATCTAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.04

Weight (kDa)

8.77

Isoelectric Point (pI)

36.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
AoxI GGCC 1 cut(s) 24
AseI ATTAAT 1 cut(s) 110
BanII GRGCYC 1 cut(s) 158
BfaI CTAG 1 cut(s) 215
BmiI GGNNCC 1 cut(s) 130
BpuEI CTTGAG 1 cut(s) 144
BsaAI YACGTR 1 cut(s) 81
Bse3DI GCAATG 2 cut(s) 175, 183
BseMI GCAATG 2 cut(s) 175, 183
BseRI GAGGAG 1 cut(s) 138
BshFI GGCC 1 cut(s) 26
BsnI GGCC 1 cut(s) 26
Bsp1286I GDGCHC 1 cut(s) 158
Bsp143I GATC 1 cut(s) 38
BspANI GGCC 1 cut(s) 26
BspLI GGNNCC 1 cut(s) 130
BsrDI GCAATG 2 cut(s) 175, 183
BssMI GATC 1 cut(s) 38
BstBAI YACGTR 1 cut(s) 81
BstC8I GCNNGC 2 cut(s) 95, 145
BstDEI CTNAG 1 cut(s) 35
BstKTI GATC 1 cut(s) 41
BstMBI GATC 1 cut(s) 38
BstMWI GCNNNNNNNGC 1 cut(s) 153
BsuRI GGCC 1 cut(s) 26
Cac8I GCNNGC 2 cut(s) 95, 145
CviAII CATG 2 cut(s) 98, 189
CviJI RGCY 6 cut(s) 26, 34, 93, 143, 156, 194
CviKI_1 RGCY 6 cut(s) 26, 34, 93, 143, 156, 194
DdeI CTNAG 1 cut(s) 35
DpnI GATC 1 cut(s) 40
DpnII GATC 1 cut(s) 38
Eco24I GRGCYC 1 cut(s) 158
EcoT38I GRGCYC 1 cut(s) 158
FaeI CATG 2 cut(s) 101, 192
FaiI YATR 4 cut(s) 14, 99, 137, 190
FalI AAGNNNNNCTT 1 cut(s) 33
FatI CATG 2 cut(s) 97, 188
FriOI GRGCYC 1 cut(s) 158
FspBI CTAG 1 cut(s) 215
HaeIII GGCC 1 cut(s) 26
Hin1II CATG 2 cut(s) 101, 192
Hpy188I TCNGA 1 cut(s) 76
HpyCH4IV ACGT 1 cut(s) 80
HpyCH4V TGCA 2 cut(s) 180, 188
HpyF10VI GCNNNNNNNGC 1 cut(s) 153
HpyF3I CTNAG 1 cut(s) 35
HpySE526I ACGT 1 cut(s) 80
Hsp92II CATG 2 cut(s) 101, 192
Kzo9I GATC 1 cut(s) 38
MaeI CTAG 1 cut(s) 215
MaeII ACGT 1 cut(s) 80
MalI GATC 1 cut(s) 40
MboI GATC 1 cut(s) 38
MboII GAAGA 1 cut(s) 16
MhlI GDGCHC 1 cut(s) 158
MluCI AATT 2 cut(s) 107, 111
MnlI CCTC 2 cut(s) 116, 119
MseI TTAA 4 cut(s) 68, 105, 110, 220
MwoI GCNNNNNNNGC 1 cut(s) 153
NdeII GATC 1 cut(s) 38
NlaIII CATG 2 cut(s) 101, 192
NlaIV GGNNCC 1 cut(s) 130
Ppu21I YACGTR 1 cut(s) 81
PshBI ATTAAT 1 cut(s) 110
PspN4I GGNNCC 1 cut(s) 130
PsrI GAACNNNNNNTAC 2 cut(s) 39, 71
SaqAI TTAA 4 cut(s) 68, 105, 110, 220
Sau3AI GATC 1 cut(s) 38
SduI GDGCHC 1 cut(s) 158
SetI ASST 4 cut(s) 19, 83, 130, 145
SmlI CTYRAG 1 cut(s) 159
SmoI CTYRAG 1 cut(s) 159
Sse9I AATT 2 cut(s) 107, 111
SspMI CTAG 1 cut(s) 215
TaiI ACGT 1 cut(s) 83
TasI AATT 2 cut(s) 107, 111
Tru1I TTAA 4 cut(s) 68, 105, 110, 220
Tru9I TTAA 4 cut(s) 68, 105, 110, 220
TspDTI ATGAA 1 cut(s) 17
VspI ATTAAT 1 cut(s) 110
XspI CTAG 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.