Prupe.1G384200_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
34480856 .. 34482054
1199 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G384200.1

Sequence Viewer

Length: 288 bp
ATGGACATGGCATGGCATATTCTTTGTGCCCGCCTGCCTGCCTGTCAATTATGGTGGTGCCTATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTGGGCCAATGGCCCACACGATATTAAATTAATTTCTTTAGAGGGAGAGCCCGCAACAGTAGCTTGCTATTGGGGTTCTCGCGCGTCGCCCAAGCGTTGCACCACAGCATGGGCCTGGCGCACCTCACCAAATCTAGTTGAGATTTTTATTTGGGCCTGCAATCTCCAAACAAACTTAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.7

Weight (kDa)

6.68

Isoelectric Point (pI)

55.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 57
AccB7I CCANNNNNTGG 1 cut(s) 213
AccII CGCG 2 cut(s) 186, 188
AciI CCGC 2 cut(s) 31, 156
AfiI CCNNNNNNNGG 1 cut(s) 213
AjnI CCWGG 1 cut(s) 218
AluBI AGCT 1 cut(s) 167
AluI AGCT 1 cut(s) 167
AoxI GGCC 4 cut(s) 108, 115, 216, 258
AseI ATTAAT 1 cut(s) 134
AspLEI GCGC 2 cut(s) 188, 225
AspS9I GGNCC 4 cut(s) 108, 116, 216, 258
AsuHPI GGTGA 1 cut(s) 222
BaeGI GKGCMC 1 cut(s) 31
BanI GGYRCC 1 cut(s) 57
BanII GRGCYC 1 cut(s) 156
BciT130I CCWGG 1 cut(s) 220
BfaI CTAG 1 cut(s) 239
Bme1390I CCNGG 1 cut(s) 220
BmgT120I GGNCC 4 cut(s) 108, 116, 216, 258
BmiI GGNNCC 1 cut(s) 59
BmrFI CCNGG 1 cut(s) 220
BsaAI YACGTR 1 cut(s) 105
Bsc4I CCNNNNNNNGG 1 cut(s) 213
BseBI CCWGG 1 cut(s) 220
BseLI CCNNNNNNNGG 1 cut(s) 213
BseSI GKGCMC 1 cut(s) 31
Bsh1236I CGCG 2 cut(s) 186, 188
BshFI GGCC 4 cut(s) 110, 117, 218, 260
BshNI GGYRCC 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 213
BsnI GGCC 4 cut(s) 110, 117, 218, 260
Bsp1286I GDGCHC 2 cut(s) 31, 156
BspACI CCGC 2 cut(s) 31, 156
BspANI GGCC 4 cut(s) 110, 117, 218, 260
BspFNI CGCG 2 cut(s) 186, 188
BspLI GGNNCC 1 cut(s) 59
BspT107I GGYRCC 1 cut(s) 57
Bst2UI CCWGG 1 cut(s) 220
Bst4CI ACNGT 1 cut(s) 163
BstBAI YACGTR 1 cut(s) 105
BstC8I GCNNGC 6 cut(s) 31, 35, 39, 156, 169, 262
BstFNI CGCG 2 cut(s) 186, 188
BstHHI GCGC 2 cut(s) 188, 225
BstMWI GCNNNNNNNGC 1 cut(s) 164
BstNI CCWGG 1 cut(s) 220
BstSCI CCNGG 1 cut(s) 218
BstSLI GKGCMC 1 cut(s) 31
BstUI CGCG 2 cut(s) 186, 188
BsuRI GGCC 4 cut(s) 110, 117, 218, 260
Cac8I GCNNGC 6 cut(s) 31, 35, 39, 156, 169, 262
CfoI GCGC 2 cut(s) 188, 225
Cfr13I GGNCC 4 cut(s) 108, 116, 216, 258
CseI GACGC 1 cut(s) 177
CspCI CAANNNNNGTGG 2 cut(s) 35, 70
CviAII CATG 3 cut(s) 7, 12, 213
CviJI RGCY 6 cut(s) 110, 117, 154, 167, 218, 260
CviKI_1 RGCY 6 cut(s) 110, 117, 154, 167, 218, 260
Eco24I GRGCYC 1 cut(s) 156
EcoRII CCWGG 1 cut(s) 218
EcoT38I GRGCYC 1 cut(s) 156
FaeI CATG 3 cut(s) 10, 15, 216
FaiI YATR 5 cut(s) 8, 13, 18, 52, 214
FatI CATG 3 cut(s) 6, 11, 212
FauI CCCGC 2 cut(s) 38, 163
FriOI GRGCYC 1 cut(s) 156
FspBI CTAG 1 cut(s) 239
GlaI GCGC 2 cut(s) 187, 224
HaeIII GGCC 4 cut(s) 110, 117, 218, 260
HgaI GACGC 1 cut(s) 177
HhaI GCGC 2 cut(s) 188, 225
Hin1II CATG 3 cut(s) 10, 15, 216
Hin6I GCGC 2 cut(s) 186, 223
HinP1I GCGC 2 cut(s) 186, 223
HphI GGTGA 1 cut(s) 222
Hpy188I TCNGA 1 cut(s) 100
Hpy99I CGWCG 1 cut(s) 193
HpyCH4III ACNGT 1 cut(s) 163
HpyCH4IV ACGT 1 cut(s) 104
HpyCH4V TGCA 2 cut(s) 204, 264
HpyF10VI GCNNNNNNNGC 1 cut(s) 164
HpySE526I ACGT 1 cut(s) 104
Hsp92II CATG 3 cut(s) 10, 15, 216
HspAI GCGC 2 cut(s) 186, 223
LpnPI CCDG 6 cut(s) 47, 51, 55, 205, 232, 274
MaeI CTAG 1 cut(s) 239
MaeII ACGT 1 cut(s) 104
MhlI GDGCHC 2 cut(s) 31, 156
MluCI AATT 4 cut(s) 47, 131, 135, 283
MnlI CCTC 2 cut(s) 139, 238
MseI TTAA 4 cut(s) 92, 129, 134, 281
MspR9I CCNGG 1 cut(s) 220
MvaI CCWGG 1 cut(s) 220
MvnI CGCG 2 cut(s) 186, 188
MwoI GCNNNNNNNGC 1 cut(s) 164
NlaIII CATG 3 cut(s) 10, 15, 216
NlaIV GGNNCC 1 cut(s) 59
PflMI CCANNNNNTGG 1 cut(s) 213
Ppu21I YACGTR 1 cut(s) 105
PshBI ATTAAT 1 cut(s) 134
Psp6I CCWGG 1 cut(s) 218
PspGI CCWGG 1 cut(s) 218
PspN4I GGNNCC 1 cut(s) 59
PspPI GGNCC 4 cut(s) 108, 116, 216, 258
PsrI GAACNNNNNNTAC 2 cut(s) 63, 95
SaqAI TTAA 4 cut(s) 92, 129, 134, 281
Sau96I GGNCC 4 cut(s) 108, 116, 216, 258
ScrFI CCNGG 1 cut(s) 220
SduI GDGCHC 2 cut(s) 31, 156
SetI ASST 3 cut(s) 107, 169, 230
Sse9I AATT 4 cut(s) 47, 131, 135, 283
SsiI CCGC 2 cut(s) 31, 156
SspMI CTAG 1 cut(s) 239
StyD4I CCNGG 1 cut(s) 218
TaaI ACNGT 1 cut(s) 163
TaiI ACGT 1 cut(s) 107
TasI AATT 4 cut(s) 47, 131, 135, 283
Tru1I TTAA 4 cut(s) 92, 129, 134, 281
Tru9I TTAA 4 cut(s) 92, 129, 134, 281
Van91I CCANNNNNTGG 1 cut(s) 213
VspI ATTAAT 1 cut(s) 134
XspI CTAG 1 cut(s) 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.