Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp06

Orthogroup ID

OG0009626

Physical Location & Seq

Genomic Coordinates Reverse (-)

5581842 .. 5584863

Gene Structure 3022 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.6G082900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 615 bp

ATGGACTACGGAATTCCATGGAATTTCTTTAGGGCTAGGGAGAAAATTGCAATCACATGCTTGAAAAGCAGAGGTTACAGTTCATCGCTTCTCATTAGGTACATTCCCAAGAAATCTTCTCAAGTTAAAATGTCGGAGAATTATCAGCAGACAGAGGCTTTCACAGCAGTTGAACTTAGAAAGAAATTACATGGAAATAACTTTACTCTAGATACCGTTGAGGCAGTGATAAATGACTTCATTAGCAGAGGCCTAATCAATGATAGCTTGTATGCAGAAGCATTTTCTTGTTCTAGATGGTCTTCCTTAAGTTGGGGACCATACTATTTCTCAGCACTTTTCAGCAAGGGAGTGAGTAAACTTGATGCTGAGAATGCAATTAAATTGGTTTTTGAGGAGGGAGAATCAGATAATGATCAGAAGTTAGTTCATGGCCTGTCAAAGCTCTCAATGGATAATTTACTTGTTCAGGCCTCAAAGCAGTGGCTTCGAGGTCAAGAAGTGCCTAAAGAGACAAGGAAATCAAGGATTGTTCATTGGCTTCAGTATCGTGGATTCAGCTGGGATGTTATTGGCTTCGTATTAAAGAAGTTAGAATCTCAGTACCCACCCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RecX

Protein Analysis

205

Amino Acids

23.52

Weight (kDa)

9.22

Isoelectric Point (pI)

31.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009626)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G13226
fragaria_vesca	FvH4_3g42180 FvH4_3g42180 FvH4_3g42180 FvH4_3g42180
malus_domestica	MD03G1037000.v1.1 MD03G1037100.v1.1
prunus_persica	Prupe.6G029100_v2.0.a1 Prupe.6G029900_v2.0.a1 Prupe.6G082900_v2.0.a1 Prupe.6G083000_v2.0.a1
pyrus_communis	pycom03g02850
rosa_chinensis	RchiOBHm_Chr5g0075451
rosa_laevigata	RLG00000036564
rosa_multiflora	Rmu_sc0000770.1_g000005
rosa_roxburghii	Rroxscaffold_1G00006050
rosa_rugosa	Rorug05G0439700
rosa_samantha	Rh5AG496700 Rh5BG518000 Rh5CG541500 Rh5DG531300
rosa_wichuraiana	Rw5G046070

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	12, 22
AcuI	CTGAAG	1 cut(s)	527
AfaI	GTAC	2 cut(s)	101, 605
AfiI	CCNNNNNNNGG	1 cut(s)	312
AflII	CTTAAG	1 cut(s)	307
AgsI	TTSAA	2 cut(s)	64, 173
AluBI	AGCT	3 cut(s)	267, 445, 561
AluI	AGCT	3 cut(s)	267, 445, 561
Alw26I	GTCTC	1 cut(s)	506
AoxI	GGCC	3 cut(s)	250, 433, 471
ApoI	RAATTY	2 cut(s)	12, 22
AspS9I	GGNCC	1 cut(s)	317
AvaII	GGWCC	1 cut(s)	317
BbsI	GAAGAC	1 cut(s)	294
BccI	CCATC	1 cut(s)	291
BcgI	CGANNNNNNTGC	2 cut(s)	470, 504
BclI	TGATCA	1 cut(s)	415
BcoDI	GTCTC	1 cut(s)	506
BfaI	CTAG	4 cut(s)	36, 209, 294, 613
BfrI	CTTAAG	1 cut(s)	307
Bme18I	GGWCC	1 cut(s)	317
BmgT120I	GGNCC	1 cut(s)	317
BmiI	GGNNCC	1 cut(s)	318
BmsI	GCATC	1 cut(s)	355
BpiI	GAAGAC	1 cut(s)	294
BpuEI	CTTGAG	1 cut(s)	105
BsaBI	GATNNNNATC	1 cut(s)	414
BsaJI	CCNNGG	1 cut(s)	17
Bsc4I	CCNNNNNNNGG	1 cut(s)	312
Bse8I	GATNNNNATC	1 cut(s)	414
BseDI	CCNNGG	1 cut(s)	17
BseGI	GGATG	1 cut(s)	571
BseJI	GATNNNNATC	1 cut(s)	414
BseLI	CCNNNNNNNGG	1 cut(s)	312
BseMII	CTCAG	3 cut(s)	345, 360, 614
BseRI	GAGGAG	1 cut(s)	410
BseYI	CCCAGC	1 cut(s)	561
BshFI	GGCC	3 cut(s)	252, 435, 473
BslFI	GGGAC	1 cut(s)	330
BslI	CCNNNNNNNGG	1 cut(s)	312
BsmAI	GTCTC	1 cut(s)	506
BsmFI	GGGAC	1 cut(s)	330
BsmI	GAATGC	1 cut(s)	379
BsnI	GGCC	3 cut(s)	252, 435, 473
Bsp143I	GATC	1 cut(s)	415
Bsp19I	CCATGG	1 cut(s)	17
BspANI	GGCC	3 cut(s)	252, 435, 473
BspCNI	CTCAG	3 cut(s)	344, 361, 613
BspLI	GGNNCC	1 cut(s)	318
BspTI	CTTAAG	1 cut(s)	307
BssECI	CCNNGG	1 cut(s)	17
BssMI	GATC	1 cut(s)	415
BssT1I	CCWWGG	1 cut(s)	17
Bst4CI	ACNGT	2 cut(s)	80, 217
BstAFI	CTTAAG	1 cut(s)	307
BstDEI	CTNAG	4 cut(s)	176, 331, 369, 600
BstDSI	CCRYGG	1 cut(s)	17
BstF5I	GGATG	1 cut(s)	571
BstKTI	GATC	1 cut(s)	418
BstMAI	GTCTC	1 cut(s)	506
BstMBI	GATC	1 cut(s)	415
BstMWI	GCNNNNNNNGC	3 cut(s)	66, 164, 374
BstNSI	RCATGY	1 cut(s)	60
BstV2I	GAAGAC	1 cut(s)	294
BsuRI	GGCC	3 cut(s)	252, 435, 473
BtgI	CCRYGG	1 cut(s)	17
BtgZI	GCGATG	1 cut(s)	69
BtsCI	GGATG	1 cut(s)	571
BtsI	GCAGTG	2 cut(s)	231, 488
BtsIMutI	CAGTG	2 cut(s)	231, 488
Cfr13I	GGNCC	1 cut(s)	317
Csp6I	GTAC	2 cut(s)	100, 604
CviAII	CATG	4 cut(s)	18, 57, 191, 431
CviQI	GTAC	2 cut(s)	100, 604
DdeI	CTNAG	4 cut(s)	176, 331, 369, 600
DpnI	GATC	1 cut(s)	417
DpnII	GATC	1 cut(s)	415
Eco130I	CCWWGG	1 cut(s)	17
Eco147I	AGGCCT	2 cut(s)	252, 473
Eco47I	GGWCC	1 cut(s)	317
Eco57I	CTGAAG	1 cut(s)	527
EcoRI	GAATTC	1 cut(s)	12
EcoT14I	CCWWGG	1 cut(s)	17
ErhI	CCWWGG	1 cut(s)	17
FaeI	CATG	4 cut(s)	21, 60, 194, 434
FaiI	YATR	6 cut(s)	19, 58, 192, 273, 322, 432
FaqI	GGGAC	1 cut(s)	330
FatI	CATG	4 cut(s)	17, 56, 190, 430
FbaI	TGATCA	1 cut(s)	415
FokI	GGATG	1 cut(s)	578
FspBI	CTAG	4 cut(s)	36, 209, 294, 613
GsaI	CCCAGC	1 cut(s)	565
HaeIII	GGCC	3 cut(s)	252, 435, 473
Hin1II	CATG	4 cut(s)	21, 60, 194, 434
HinfI	GANTC	3 cut(s)	404, 555, 596
Hpy166II	GTNNAC	1 cut(s)	359
Hpy188I	TCNGA	3 cut(s)	136, 409, 420
Hpy188III	TCNNGA	3 cut(s)	209, 294, 497
Hpy8I	GTNNAC	1 cut(s)	359
HpyCH4III	ACNGT	2 cut(s)	80, 217
HpyCH4V	TGCA	3 cut(s)	50, 275, 377
HpyF10VI	GCNNNNNNNGC	3 cut(s)	66, 164, 374
HpyF3I	CTNAG	4 cut(s)	176, 331, 369, 600
Hsp92II	CATG	4 cut(s)	21, 60, 194, 434
Ksp22I	TGATCA	1 cut(s)	415
Kzo9I	GATC	1 cut(s)	415
LpnPI	CCDG	3 cut(s)	449, 455, 547
LweI	GCATC	1 cut(s)	355
MaeI	CTAG	4 cut(s)	36, 209, 294, 613
MaeIII	GTNAC	1 cut(s)	74
MalI	GATC	1 cut(s)	417
MboI	GATC	1 cut(s)	415
MboII	GAAGA	2 cut(s)	108, 294
MluCI	AATT	8 cut(s)	12, 22, 45, 139, 185, 378, 383, 457
MmeI	TCCRAC	1 cut(s)	114
MnlI	CCTC	8 cut(s)	65, 148, 214, 242, 388, 391, 484, 485
MseI	TTAA	4 cut(s)	126, 308, 381, 584
MspA1I	CMGCKG	1 cut(s)	561
MspCI	CTTAAG	1 cut(s)	307
Mva1269I	GAATGC	1 cut(s)	379
MwoI	GCNNNNNNNGC	3 cut(s)	66, 164, 374
NcoI	CCATGG	1 cut(s)	17
NdeII	GATC	1 cut(s)	415
NlaIII	CATG	4 cut(s)	21, 60, 194, 434
NlaIV	GGNNCC	1 cut(s)	318
NspI	RCATGY	1 cut(s)	60
PceI	AGGCCT	2 cut(s)	252, 473
PctI	GAATGC	1 cut(s)	379
PfeI	GAWTC	3 cut(s)	404, 555, 596
PspFI	CCCAGC	1 cut(s)	561
PspN4I	GGNNCC	1 cut(s)	318
PspPI	GGNCC	1 cut(s)	317
PvuII	CAGCTG	1 cut(s)	561
RsaI	GTAC	2 cut(s)	101, 605
RsaNI	GTAC	2 cut(s)	100, 604
SaqAI	TTAA	4 cut(s)	126, 308, 381, 584
Sau3AI	GATC	1 cut(s)	415
Sau96I	GGNCC	1 cut(s)	317
SetI	ASST	6 cut(s)	76, 101, 269, 447, 496, 563
SfaNI	GCATC	1 cut(s)	355
SinI	GGWCC	1 cut(s)	317
SmlI	CTYRAG	2 cut(s)	120, 307
SmoI	CTYRAG	2 cut(s)	120, 307
Sse9I	AATT	8 cut(s)	12, 22, 45, 139, 185, 378, 383, 457
SseBI	AGGCCT	2 cut(s)	252, 473
SspMI	CTAG	4 cut(s)	36, 209, 294, 613
StuI	AGGCCT	2 cut(s)	252, 473
StyI	CCWWGG	1 cut(s)	17
TaaI	ACNGT	2 cut(s)	80, 217
TaqI	TCGA	1 cut(s)	490
TasI	AATT	8 cut(s)	12, 22, 45, 139, 185, 378, 383, 457
TfiI	GAWTC	3 cut(s)	404, 555, 596
Tru1I	TTAA	4 cut(s)	126, 308, 381, 584
Tru9I	TTAA	4 cut(s)	126, 308, 381, 584
TscAI	CASTG	2 cut(s)	231, 488
TspDTI	ATGAA	4 cut(s)	72, 229, 419, 524
TspGWI	ACGGA	1 cut(s)	24
TspRI	CASTG	2 cut(s)	231, 488
Vha464I	CTTAAG	1 cut(s)	307
VpaK11BI	GGWCC	1 cut(s)	317
XapI	RAATTY	2 cut(s)	12, 22
XbaI	TCTAGA	2 cut(s)	208, 293
XceI	RCATGY	1 cut(s)	60
XspI	CTAG	4 cut(s)	36, 209, 294, 613

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.