Prupe.6G123400_v2.0.a1

protein histidine kinase binding

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
9204976 .. 9206776
1801 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G123400.1

Sequence Viewer

Length: 462 bp
ATGGCTGCGAAAGGGAAGGATCTTAGCCAACAGCTCGTGGAACTCATCAGCTCCTTGCAAGAACAAGGCATTTTGACCGACTACTTTGACGACATAAAAGATTTACAAGATGAAATCAACCCTCGCTTCGTTGACGAAATTTTCACCATCTTCCTTCGTGTAGCTGAAGATTACAGAGCCGAACTCACAAGAAATCTGAGTGAGCCTGATGTCAACTATCCTGAGGTGAATAAACTCGCAATCAGGTTTAAAAGTAGTAGCACAAGTAATGCCTGTGGCCTGGTTGCCCTTGCCTGTCAAGAGCTTGTTGATGCAAGTGAAGCAAAGAACAAAGAAGGGTGCCTTGTGGCTCTTGACAATGTCAACCGTGAATATCTTGTCGCCAAAGAGAATTTGAATCGCATTGTTGGGATGGAACGTGAAATTTATGACATGAAGCTGTGCCAAAAGCAACCTGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

154

Amino Acids

17.38

Weight (kDa)

4.59

Isoelectric Point (pI)

46.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 339
AclWI GGATC 1 cut(s) 27
AcsI RAATTY 3 cut(s) 138, 391, 423
AcuI CTGAAG 1 cut(s) 186
AgsI TTSAA 1 cut(s) 397
AjnI CCWGG 1 cut(s) 279
AluBI AGCT 5 cut(s) 34, 51, 164, 304, 439
AluI AGCT 5 cut(s) 34, 51, 164, 304, 439
AlwI GGATC 1 cut(s) 27
AoxI GGCC 1 cut(s) 277
ApeKI GCWGC 1 cut(s) 5
ApoI RAATTY 3 cut(s) 138, 391, 423
AsuHPI GGTGA 2 cut(s) 136, 238
AxyI CCTNAGG 1 cut(s) 222
BanI GGYRCC 1 cut(s) 339
BauI CACGAG 1 cut(s) 35
BccI CCATC 2 cut(s) 155, 406
BciT130I CCWGG 1 cut(s) 281
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 281
BmiI GGNNCC 1 cut(s) 341
BmrFI CCNGG 1 cut(s) 281
BmsI GCATC 1 cut(s) 301
BplI GAGNNNNNCTC 2 cut(s) 168, 200
Bse21I CCTNAGG 1 cut(s) 222
BseBI CCWGG 1 cut(s) 281
BseGI GGATG 1 cut(s) 417
BseMII CTCAG 3 cut(s) 188, 213, 447
BshFI GGCC 1 cut(s) 279
BshNI GGYRCC 1 cut(s) 339
BsnI GGCC 1 cut(s) 279
Bsp143I GATC 1 cut(s) 19
BspANI GGCC 1 cut(s) 279
BspCNI CTCAG 3 cut(s) 189, 214, 448
BspLI GGNNCC 1 cut(s) 341
BspPI GGATC 1 cut(s) 27
BspT107I GGYRCC 1 cut(s) 339
BssMI GATC 1 cut(s) 19
BssSI CACGAG 1 cut(s) 35
Bst2BI CACGAG 1 cut(s) 35
Bst2UI CCWGG 1 cut(s) 281
Bst4CI ACNGT 1 cut(s) 368
BstDEI CTNAG 4 cut(s) 23, 197, 222, 456
BstF5I GGATG 1 cut(s) 417
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstMWI GCNNNNNNNGC 1 cut(s) 320
BstNI CCWGG 1 cut(s) 281
BstSCI CCNGG 1 cut(s) 279
BstX2I RGATCY 1 cut(s) 19
BstYI RGATCY 1 cut(s) 19
Bsu36I CCTNAGG 1 cut(s) 222
BsuRI GGCC 1 cut(s) 279
BtsCI GGATG 1 cut(s) 417
CviAII CATG 1 cut(s) 433
DdeI CTNAG 4 cut(s) 23, 197, 222, 456
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
DraI TTTAAA 1 cut(s) 250
Eco57I CTGAAG 1 cut(s) 186
Eco81I CCTNAGG 1 cut(s) 222
EcoRII CCWGG 1 cut(s) 279
FaeI CATG 1 cut(s) 436
FaiI YATR 3 cut(s) 95, 429, 434
FalI AAGNNNNNCTT 2 cut(s) 327, 359
FatI CATG 1 cut(s) 432
Fnu4HI GCNGC 1 cut(s) 6
FokI GGATG 1 cut(s) 424
Fsp4HI GCNGC 1 cut(s) 6
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 279
Hin1II CATG 1 cut(s) 436
HincII GTYRAC 3 cut(s) 133, 214, 364
HindII GTYRAC 3 cut(s) 133, 214, 364
HinfI GANTC 1 cut(s) 397
HphI GGTGA 2 cut(s) 136, 238
Hpy166II GTNNAC 3 cut(s) 133, 214, 364
Hpy188I TCNGA 1 cut(s) 198
Hpy188III TCNNGA 3 cut(s) 221, 299, 353
Hpy8I GTNNAC 3 cut(s) 133, 214, 364
HpyAV CCTTC 3 cut(s) 10, 164, 329
HpyCH4III ACNGT 1 cut(s) 368
HpyCH4IV ACGT 1 cut(s) 418
HpyCH4V TGCA 2 cut(s) 58, 314
HpyF10VI GCNNNNNNNGC 1 cut(s) 320
HpyF3I CTNAG 4 cut(s) 23, 197, 222, 456
HpySE526I ACGT 1 cut(s) 418
Hsp92II CATG 1 cut(s) 436
Kzo9I GATC 1 cut(s) 19
LmnI GCTCC 1 cut(s) 56
LpnPI CCDG 7 cut(s) 219, 229, 234, 266, 286, 293, 307
LweI GCATC 1 cut(s) 301
MaeII ACGT 1 cut(s) 418
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MboII GAAGA 2 cut(s) 142, 179
MflI RGATCY 1 cut(s) 19
MluCI AATT 3 cut(s) 138, 391, 423
MnlI CCTC 2 cut(s) 132, 217
MseI TTAA 1 cut(s) 249
MspR9I CCNGG 1 cut(s) 281
MvaI CCWGG 1 cut(s) 281
MwoI GCNNNNNNNGC 1 cut(s) 320
NdeII GATC 1 cut(s) 19
NlaIII CATG 1 cut(s) 436
NlaIV GGNNCC 1 cut(s) 341
PfeI GAWTC 1 cut(s) 397
PflFI GACNNNGTC 1 cut(s) 359
PkrI GCNGC 1 cut(s) 7
Psp6I CCWGG 1 cut(s) 279
PspGI CCWGG 1 cut(s) 279
PspN4I GGNNCC 1 cut(s) 341
PsuI RGATCY 1 cut(s) 19
PsyI GACNNNGTC 1 cut(s) 359
SaqAI TTAA 1 cut(s) 249
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 1 cut(s) 19
ScrFI CCNGG 1 cut(s) 281
SetI ASST 9 cut(s) 36, 53, 166, 228, 248, 306, 421, 441, 457
SfaNI GCATC 1 cut(s) 301
Sse9I AATT 3 cut(s) 138, 391, 423
StyD4I CCNGG 1 cut(s) 279
TaaI ACNGT 1 cut(s) 368
TaiI ACGT 1 cut(s) 421
TaqII GACCGA 1 cut(s) 92
TasI AATT 3 cut(s) 138, 391, 423
TfiI GAWTC 1 cut(s) 397
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TseI GCWGC 1 cut(s) 5
TspDTI ATGAA 2 cut(s) 126, 449
Tth111I GACNNNGTC 1 cut(s) 359
XapI RAATTY 3 cut(s) 138, 391, 423
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.