Rmu_sc0001366.1_g000018

protein histidine kinase binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001366.1
Physical Location & Seq
Forward (+)
47157 .. 47649
493 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001366.1_g000018.1.cds

Sequence Viewer

Length: 264 bp
atggccggaaaggatctcaaccagaagctcaatgaactcatcagctccttgcaagaccagggcattctggatgactactttgatgaactgaaagggttacaagatgaacaaagtccacagtttgttactaacactataactatttaccttggtggagcagatgatacgatagctgaactcacccaaaatctgagtgagcctgcagtgaactatcccagggtgacttatcttgcggataaactgaagggaagtagcatgaggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.67

Weight (kDa)

4.21

Isoelectric Point (pI)

32.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 233
AclWI GGATC 1 cut(s) 21
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 263
AjnI CCWGG 2 cut(s) 57, 215
AluBI AGCT 3 cut(s) 28, 45, 173
AluI AGCT 3 cut(s) 28, 45, 173
AlwI GGATC 1 cut(s) 21
AoxI GGCC 1 cut(s) 3
AsuHPI GGTGA 2 cut(s) 172, 232
BciT130I CCWGG 2 cut(s) 59, 217
BfmI CTRYAG 1 cut(s) 201
Bme1390I CCNGG 2 cut(s) 59, 217
BmrFI CCNGG 2 cut(s) 59, 217
BsaJI CCNNGG 4 cut(s) 58, 148, 215, 216
BseBI CCWGG 2 cut(s) 59, 217
BseDI CCNNGG 4 cut(s) 58, 148, 215, 216
BseGI GGATG 1 cut(s) 76
BseMII CTCAG 1 cut(s) 182
BshFI GGCC 1 cut(s) 5
BsiSI CCGG 1 cut(s) 6
BsmI GAATGC 1 cut(s) 63
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 13
BspACI CCGC 1 cut(s) 233
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 183
BspMAI CTGCAG 1 cut(s) 205
BspPI GGATC 1 cut(s) 21
BssECI CCNNGG 4 cut(s) 58, 148, 215, 216
BssMI GATC 1 cut(s) 13
BssT1I CCWWGG 1 cut(s) 148
Bst2UI CCWGG 2 cut(s) 59, 217
Bst4CI ACNGT 1 cut(s) 120
BstC8I GCNNGC 1 cut(s) 201
BstDEI CTNAG 1 cut(s) 191
BstF5I GGATG 1 cut(s) 76
BstKTI GATC 1 cut(s) 16
BstMBI GATC 1 cut(s) 13
BstNI CCWGG 2 cut(s) 59, 217
BstSCI CCNGG 2 cut(s) 57, 215
BstSFI CTRYAG 1 cut(s) 201
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 76
BtsI GCAGTG 1 cut(s) 210
BtsIMutI CAGTG 1 cut(s) 210
Cac8I GCNNGC 1 cut(s) 201
CviAII CATG 1 cut(s) 256
CviJI RGCY 5 cut(s) 5, 28, 45, 173, 199
CviKI_1 RGCY 5 cut(s) 5, 28, 45, 173, 199
DdeI CTNAG 1 cut(s) 191
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 148
Eco57I CTGAAG 1 cut(s) 263
EcoRII CCWGG 2 cut(s) 57, 215
EcoT14I CCWWGG 1 cut(s) 148
ErhI CCWWGG 1 cut(s) 148
FaeI CATG 1 cut(s) 259
FaiI YATR 2 cut(s) 137, 257
FatI CATG 1 cut(s) 255
FokI GGATG 1 cut(s) 83
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 6
Hin1II CATG 1 cut(s) 259
HpaII CCGG 1 cut(s) 6
HphI GGTGA 2 cut(s) 172, 232
Hpy166II GTNNAC 2 cut(s) 116, 208
Hpy188I TCNGA 1 cut(s) 192
Hpy188III TCNNGA 1 cut(s) 68
Hpy8I GTNNAC 2 cut(s) 116, 208
HpyAV CCTTC 1 cut(s) 238
HpyCH4III ACNGT 1 cut(s) 120
HpyCH4V TGCA 2 cut(s) 52, 203
HpyF3I CTNAG 1 cut(s) 191
Hsp92II CATG 1 cut(s) 259
Kzo9I GATC 1 cut(s) 13
LmnI GCTCC 2 cut(s) 50, 155
LpnPI CCDG 8 cut(s) 19, 35, 44, 53, 71, 202, 213, 229
MaeIII GTNAC 3 cut(s) 96, 124, 220
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MflI RGATCY 1 cut(s) 13
MnlI CCTC 1 cut(s) 252
MspI CCGG 1 cut(s) 6
MspR9I CCNGG 2 cut(s) 59, 217
Mva1269I GAATGC 1 cut(s) 63
MvaI CCWGG 2 cut(s) 59, 217
NdeII GATC 1 cut(s) 13
NlaIII CATG 1 cut(s) 259
NmuCI GTSAC 1 cut(s) 220
PasI CCCWGGG 1 cut(s) 216
PctI GAATGC 1 cut(s) 63
Psp6I CCWGG 2 cut(s) 57, 215
PspGI CCWGG 2 cut(s) 57, 215
PstI CTGCAG 1 cut(s) 205
PsuI RGATCY 1 cut(s) 13
Sau3AI GATC 1 cut(s) 13
ScrFI CCNGG 2 cut(s) 59, 217
SetI ASST 5 cut(s) 30, 47, 150, 175, 263
SfcI CTRYAG 1 cut(s) 201
SsiI CCGC 1 cut(s) 233
StyD4I CCNGG 2 cut(s) 57, 215
StyI CCWWGG 1 cut(s) 148
TaaI ACNGT 1 cut(s) 120
TscAI CASTG 1 cut(s) 210
TseFI GTSAC 1 cut(s) 220
Tsp45I GTSAC 1 cut(s) 220
TspDTI ATGAA 3 cut(s) 48, 99, 120
TspRI CASTG 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.