Prupe.6G123600_v2.0.a1

protein histidine kinase binding

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
9216717 .. 9219092
2376 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G123600.1

Sequence Viewer

Length: 288 bp
ATGTCTGGGAAGGAACTTGGCCAAGAGTTCAAGGAACTCGTCAGCTCCTTGCAAGACCAAGGAATTTTGGACGAGCAATTTGATCAAATGAAAGCAGTTCAGAATGAACGAAATCCTTGCTTTGTTGCGAATTTGATCACCACATTCCTTGGTGATGTTGAAAATATTTTGGCACAACTCAGCACATATCTGAGTGCTGAGGATCCTGATGAAGTCAACTATCCCCAGGTGGCAACTCTTGCCCTCACGCTCAAGTGTTGGTGGTTGCCGGATGGCGTTAGCCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

10.62

Weight (kDa)

4.05

Isoelectric Point (pI)

41.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 197, 210
AcoI YGGCCR 1 cut(s) 19
AcsI RAATTY 2 cut(s) 63, 130
AgsI TTSAA 2 cut(s) 31, 161
AjnI CCWGG 1 cut(s) 225
AluBI AGCT 1 cut(s) 45
AluI AGCT 1 cut(s) 45
AlwI GGATC 2 cut(s) 197, 210
AoxI GGCC 1 cut(s) 19
ApoI RAATTY 2 cut(s) 63, 130
ArsI GACNNNNNNTTYG 2 cut(s) 62, 94
AsuHPI GGTGA 2 cut(s) 130, 164
BalI TGGCCA 1 cut(s) 21
BamHI GGATCC 1 cut(s) 202
BbvCI CCTCAGC 1 cut(s) 198
BccI CCATC 1 cut(s) 266
BcgI CGANNNNNNTGC 2 cut(s) 99, 133
BciT130I CCWGG 1 cut(s) 227
BclI TGATCA 2 cut(s) 82, 135
BfmI CTRYAG 1 cut(s) 284
Bme1390I CCNGG 1 cut(s) 227
BmiI GGNNCC 1 cut(s) 204
BmrFI CCNGG 1 cut(s) 227
Bpu10I CCTNAGC 1 cut(s) 198
BpuEI CTTGAG 1 cut(s) 236
BsaJI CCNNGG 3 cut(s) 58, 148, 225
BseBI CCWGG 1 cut(s) 227
BseDI CCNNGG 3 cut(s) 58, 148, 225
BseGI GGATG 1 cut(s) 277
BseMII CTCAG 3 cut(s) 182, 189, 193
BshFI GGCC 1 cut(s) 21
BsiSI CCGG 1 cut(s) 269
BsnI GGCC 1 cut(s) 21
Bsp143I GATC 3 cut(s) 82, 135, 202
BspANI GGCC 1 cut(s) 21
BspCNI CTCAG 3 cut(s) 183, 190, 192
BspLI GGNNCC 1 cut(s) 204
BspPI GGATC 2 cut(s) 197, 210
BssECI CCNNGG 3 cut(s) 58, 148, 225
BssMI GATC 3 cut(s) 82, 135, 202
BssT1I CCWWGG 2 cut(s) 58, 148
Bst2UI CCWGG 1 cut(s) 227
BstAPI GCANNNNNTGC 1 cut(s) 239
BstDEI CTNAG 3 cut(s) 179, 191, 198
BstF5I GGATG 1 cut(s) 277
BstKTI GATC 3 cut(s) 85, 138, 205
BstMBI GATC 3 cut(s) 82, 135, 202
BstMWI GCNNNNNNNGC 1 cut(s) 239
BstNI CCWGG 1 cut(s) 227
BstSCI CCNGG 1 cut(s) 225
BstSFI CTRYAG 1 cut(s) 284
BstX2I RGATCY 1 cut(s) 202
BstYI RGATCY 1 cut(s) 202
BsuRI GGCC 1 cut(s) 21
BtsCI GGATG 1 cut(s) 277
CspCI CAANNNNNGTGG 2 cut(s) 130, 165
CviJI RGCY 3 cut(s) 21, 45, 282
CviKI_1 RGCY 3 cut(s) 21, 45, 282
DdeI CTNAG 3 cut(s) 179, 191, 198
DpnI GATC 3 cut(s) 84, 137, 204
DpnII GATC 3 cut(s) 82, 135, 202
EaeI YGGCCR 1 cut(s) 19
Eco130I CCWWGG 2 cut(s) 58, 148
EcoRII CCWGG 1 cut(s) 225
EcoT14I CCWWGG 2 cut(s) 58, 148
ErhI CCWWGG 2 cut(s) 58, 148
FaiI YATR 1 cut(s) 187
FbaI TGATCA 2 cut(s) 82, 135
FokI GGATG 1 cut(s) 284
HaeIII GGCC 1 cut(s) 21
HapII CCGG 1 cut(s) 269
HincII GTYRAC 1 cut(s) 217
HindII GTYRAC 1 cut(s) 217
HpaII CCGG 1 cut(s) 269
HphI GGTGA 2 cut(s) 130, 164
Hpy166II GTNNAC 1 cut(s) 217
Hpy188I TCNGA 2 cut(s) 102, 192
Hpy188III TCNNGA 1 cut(s) 206
Hpy8I GTNNAC 1 cut(s) 217
HpyAV CCTTC 1 cut(s) 4
HpyCH4V TGCA 1 cut(s) 52
HpyF10VI GCNNNNNNNGC 1 cut(s) 239
HpyF3I CTNAG 3 cut(s) 179, 191, 198
Ksp22I TGATCA 2 cut(s) 82, 135
Kzo9I GATC 3 cut(s) 82, 135, 202
LmnI GCTCC 1 cut(s) 50
LpnPI CCDG 4 cut(s) 212, 219, 239, 282
MalI GATC 3 cut(s) 84, 137, 204
MboI GATC 3 cut(s) 82, 135, 202
MflI RGATCY 1 cut(s) 202
MlsI TGGCCA 1 cut(s) 21
MluCI AATT 3 cut(s) 63, 77, 130
MluNI TGGCCA 1 cut(s) 21
MnlI CCTC 2 cut(s) 193, 254
Mox20I TGGCCA 1 cut(s) 21
MscI TGGCCA 1 cut(s) 21
Msp20I TGGCCA 1 cut(s) 21
MspI CCGG 1 cut(s) 269
MspR9I CCNGG 1 cut(s) 227
MvaI CCWGG 1 cut(s) 227
MwoI GCNNNNNNNGC 1 cut(s) 239
NdeII GATC 3 cut(s) 82, 135, 202
NlaIV GGNNCC 1 cut(s) 204
Psp6I CCWGG 1 cut(s) 225
PspGI CCWGG 1 cut(s) 225
PspN4I GGNNCC 1 cut(s) 204
PsuI RGATCY 1 cut(s) 202
Sau3AI GATC 3 cut(s) 82, 135, 202
ScrFI CCNGG 1 cut(s) 227
SetI ASST 2 cut(s) 47, 231
SfcI CTRYAG 1 cut(s) 284
SmlI CTYRAG 1 cut(s) 251
SmoI CTYRAG 1 cut(s) 251
Sse9I AATT 3 cut(s) 63, 77, 130
SspI AATATT 1 cut(s) 166
StyD4I CCNGG 1 cut(s) 225
StyI CCWWGG 2 cut(s) 58, 148
TasI AATT 3 cut(s) 63, 77, 130
TspDTI ATGAA 3 cut(s) 104, 120, 225
XapI RAATTY 2 cut(s) 63, 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.