Prupe.7G032700_v2.0.a1

Microtubule-associated protein 70-2-like

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
6085783 .. 6090988
5206 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G032700.1

Sequence Viewer

Length: 372 bp
ATGGAAAATCACGTCCATCCTCAGATGCAAGAGTCATCAGCAATGGGCCTTCAGTCTCTTGGTGGAGCTGAGAACTTCTCTAGAGCGTCCTCTAATGGCTATCTATCTAGGACAAAATCGAATTTACAATCTGGTTTCAACCGTTCCAACACAGCTACTGCAATATTGAAACAAGCCAAGAGTTCATCTAGATCGTTTGATGGTGGTAGTAGATTGCTAGACAGATATAAGCTAGTCCCAGATGCAACTGGGAAAGATAACACAAACAGTGCCAGTGATCAGACTCAGATGGATGAGACAATTGGTAGACATGAGGAGAGGGCAAATGGATCTTTGGCTGAACAATACAGGACAGAGCATGTGGTAGATTGA

Protein Analysis

124

Amino Acids

13.45

Weight (kDa)

6.41

Isoelectric Point (pI)

44.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 307
AclWI GGATC 1 cut(s) 337
AcsI RAATTY 1 cut(s) 121
AcuI CTGAAG 1 cut(s) 35
AgsI TTSAA 2 cut(s) 139, 169
AjiI CACGTC 1 cut(s) 13
AluBI AGCT 3 cut(s) 68, 155, 232
AluI AGCT 3 cut(s) 68, 155, 232
Alw26I GTCTC 2 cut(s) 60, 290
AlwI GGATC 1 cut(s) 337
AlwNI CAGNNNCTG 1 cut(s) 158
AoxI GGCC 1 cut(s) 46
ApoI RAATTY 1 cut(s) 121
AspS9I GGNCC 1 cut(s) 46
BccI CCATC 3 cut(s) 24, 194, 283
BclI TGATCA 1 cut(s) 277
BcoDI GTCTC 2 cut(s) 60, 290
BfaI CTAG 5 cut(s) 81, 108, 189, 218, 233
BmgBI CACGTC 1 cut(s) 13
BmgT120I GGNCC 1 cut(s) 46
BmrI ACTGGG 1 cut(s) 258
BmsI GCATC 2 cut(s) 15, 232
BmuI ACTGGG 1 cut(s) 258
BplI GAGNNNNNCTC 2 cut(s) 62, 94
Bse1I ACTGG 2 cut(s) 253, 273
Bse3DI GCAATG 1 cut(s) 48
BseGI GGATG 2 cut(s) 16, 298
BseMI GCAATG 1 cut(s) 48
BseMII CTCAG 3 cut(s) 35, 60, 299
BseNI ACTGG 2 cut(s) 253, 273
BseRI GAGGAG 1 cut(s) 329
BshFI GGCC 1 cut(s) 48
BslFI GGGAC 1 cut(s) 221
BsmAI GTCTC 2 cut(s) 60, 290
BsmFI GGGAC 1 cut(s) 221
BsnI GGCC 1 cut(s) 48
Bsp143I GATC 3 cut(s) 191, 277, 329
BspANI GGCC 1 cut(s) 48
BspCNI CTCAG 3 cut(s) 34, 61, 298
BspPI GGATC 1 cut(s) 337
BsrDI GCAATG 1 cut(s) 48
BsrI ACTGG 2 cut(s) 253, 273
BssMI GATC 3 cut(s) 191, 277, 329
Bst4CI ACNGT 2 cut(s) 143, 269
BstDEI CTNAG 3 cut(s) 21, 69, 285
BstF5I GGATG 2 cut(s) 16, 298
BstKTI GATC 3 cut(s) 194, 280, 332
BstMAI GTCTC 2 cut(s) 60, 290
BstMBI GATC 3 cut(s) 191, 277, 329
BstNSI RCATGY 1 cut(s) 362
BstX2I RGATCY 1 cut(s) 329
BstYI RGATCY 1 cut(s) 329
BsuRI GGCC 1 cut(s) 48
BtrI CACGTC 1 cut(s) 13
BtsCI GGATG 2 cut(s) 16, 298
BtsIMutI CAGTG 2 cut(s) 274, 280
CaiI CAGNNNCTG 1 cut(s) 158
Cfr13I GGNCC 1 cut(s) 46
CseI GACGC 1 cut(s) 75
CviAII CATG 2 cut(s) 311, 359
CviJI RGCY 7 cut(s) 48, 68, 99, 155, 176, 232, 338
CviKI_1 RGCY 7 cut(s) 48, 68, 99, 155, 176, 232, 338
DdeI CTNAG 3 cut(s) 21, 69, 285
DpnI GATC 3 cut(s) 193, 279, 331
DpnII GATC 3 cut(s) 191, 277, 329
Eco57I CTGAAG 1 cut(s) 35
FaeI CATG 2 cut(s) 314, 362
FaiI YATR 3 cut(s) 228, 312, 360
FaqI GGGAC 1 cut(s) 221
FatI CATG 2 cut(s) 310, 358
FbaI TGATCA 1 cut(s) 277
FblI GTMKAC 1 cut(s) 307
FokI GGATG 2 cut(s) 3, 305
FspBI CTAG 5 cut(s) 81, 108, 189, 218, 233
HaeIII GGCC 1 cut(s) 48
HgaI GACGC 1 cut(s) 75
Hin1II CATG 2 cut(s) 314, 362
HinfI GANTC 2 cut(s) 32, 283
Hpy166II GTNNAC 1 cut(s) 308
Hpy188I TCNGA 3 cut(s) 24, 282, 288
Hpy188III TCNNGA 2 cut(s) 81, 189
Hpy8I GTNNAC 1 cut(s) 308
HpyAV CCTTC 1 cut(s) 59
HpyCH4III ACNGT 2 cut(s) 143, 269
HpyCH4IV ACGT 1 cut(s) 12
HpyCH4V TGCA 3 cut(s) 28, 161, 245
HpyF3I CTNAG 3 cut(s) 21, 69, 285
HpySE526I ACGT 1 cut(s) 12
Hsp92II CATG 2 cut(s) 314, 362
Ksp22I TGATCA 1 cut(s) 277
Kzo9I GATC 3 cut(s) 191, 277, 329
LmnI GCTCC 1 cut(s) 65
LpnPI CCDG 5 cut(s) 117, 234, 252, 286, 334
LweI GCATC 2 cut(s) 15, 232
MaeI CTAG 5 cut(s) 81, 108, 189, 218, 233
MaeII ACGT 1 cut(s) 12
MalI GATC 3 cut(s) 193, 279, 331
MboI GATC 3 cut(s) 191, 277, 329
MfeI CAATTG 1 cut(s) 300
MflI RGATCY 1 cut(s) 329
MluCI AATT 2 cut(s) 121, 300
MlyI GAGTC 2 cut(s) 41, 277
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 4 cut(s) 30, 100, 307, 312
MunI CAATTG 1 cut(s) 300
NdeII GATC 3 cut(s) 191, 277, 329
NlaIII CATG 2 cut(s) 314, 362
NspI RCATGY 1 cut(s) 362
PleI GAGTC 2 cut(s) 40, 277
PpsI GAGTC 2 cut(s) 40, 277
PspPI GGNCC 1 cut(s) 46
PstNI CAGNNNCTG 1 cut(s) 158
PsuI RGATCY 1 cut(s) 329
Sau3AI GATC 3 cut(s) 191, 277, 329
Sau96I GGNCC 1 cut(s) 46
SchI GAGTC 2 cut(s) 41, 277
SetI ASST 4 cut(s) 15, 70, 157, 234
SfaNI GCATC 2 cut(s) 15, 232
Sse9I AATT 2 cut(s) 121, 300
SspI AATATT 1 cut(s) 165
SspMI CTAG 5 cut(s) 81, 108, 189, 218, 233
TaaI ACNGT 2 cut(s) 143, 269
TaiI ACGT 1 cut(s) 15
TaqI TCGA 1 cut(s) 119
TasI AATT 2 cut(s) 121, 300
TscAI CASTG 2 cut(s) 274, 280
TspDTI ATGAA 1 cut(s) 174
TspRI CASTG 2 cut(s) 274, 280
XapI RAATTY 1 cut(s) 121
XbaI TCTAGA 2 cut(s) 80, 188
XceI RCATGY 1 cut(s) 362
XmiI GTMKAC 1 cut(s) 307
XspI CTAG 5 cut(s) 81, 108, 189, 218, 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.