Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp07

Orthogroup ID

OG0014496

Physical Location & Seq

Genomic Coordinates Forward (+)

11361514 .. 11363718

Gene Structure 2205 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.7G077000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 477 bp

ATGGACCCTCTTCCTACTCCAACTCCAACTCCAACTCCAGCTCCTGCTGCTACCTCAGCTAGTGTTCAACATGTAAACAAGAAGTCCTCCGATGAGCTGCTAAGAAAGTTTGCTGATTCAGGGGATGAGGCTGAGGAGGCCCCAGAAAAGAAACAAGTGATTCGGGTGTCGAAACGCCGGAAAGTGAGAAACCGGGCAAGTGGTGAAGGGGAGCAATGTGAGAGCCCATCAAATGGCAAGAACAGCTTAGTGGAGAGAAGGTCTCTGCTTCCTGCTGCTGGGACTAAGAACAAGGCATTGCTTAGGCAACTTGGGGTTCATGGCAGGGCATCACAACTCAGGGCCAGGGATATCAGGAACAAGTCTTTCTTTGGTGCCATTCACAAGACATGGAGAAGGACCATAGAAGGGGCTTCAAAGGTTTTCATGGAGAAGCATTACAATAGGCACAAGCGTTTGATAAGTGACATTGCCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

159

Amino Acids

17.59

Weight (kDa)

10.55

Isoelectric Point (pI)

64.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014496)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G42110
fragaria_vesca	FvH4_6g22320
malus_domestica	MD12G1057100.v1.1 MD14G1057700.v1.1
prunus_persica	Prupe.7G077000_v2.0.a1
pyrus_communis	pycom12g05100 pycom14g04680
rosa_chinensis	RchiOBHm_Chr3g0479681
rosa_laevigata	RLG00000023548
rosa_multiflora	Rmu_sc0003755.1_g000005
rosa_roxburghii	Rroxscaffold_6G00402070
rosa_rugosa	Rorug03G0177400
rosa_samantha	Rh3AG228100 Rh3BG261300 Rh3CG258400 Rh3DG254600
rosa_wichuraiana	Rw3G020410

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	374
AccB7I	CCANNNNNTGG	1 cut(s)	233
AfiI	CCNNNNNNNGG	3 cut(s)	233, 278, 408
AflIII	ACRYGT	1 cut(s)	70
AgsI	TTSAA	2 cut(s)	68, 417
AjnI	CCWGG	1 cut(s)	344
AluBI	AGCT	4 cut(s)	41, 59, 97, 246
AluI	AGCT	4 cut(s)	41, 59, 97, 246
Alw26I	GTCTC	1 cut(s)	267
AlwNI	CAGNNNCTG	1 cut(s)	44
AoxI	GGCC	2 cut(s)	138, 342
ApeKI	GCWGC	3 cut(s)	47, 97, 275
AspS9I	GGNCC	4 cut(s)	4, 139, 342, 399
AsuC2I	CCSGG	1 cut(s)	194
AsuHPI	GGTGA	1 cut(s)	215
AvaII	GGWCC	2 cut(s)	4, 399
BanI	GGYRCC	1 cut(s)	374
BanII	GRGCYC	1 cut(s)	227
BbvCI	CCTCAGC	2 cut(s)	55, 132
BbvI	GCAGC	3 cut(s)	34, 84, 262
BccI	CCATC	1 cut(s)	235
BciT130I	CCWGG	1 cut(s)	346
BcnI	CCSGG	1 cut(s)	194
BcoDI	GTCTC	1 cut(s)	267
BfaI	CTAG	2 cut(s)	60, 475
BisI	GCNGC	3 cut(s)	48, 98, 276
BlsI	GCNGC	3 cut(s)	49, 99, 277
Bme1390I	CCNGG	2 cut(s)	194, 346
Bme18I	GGWCC	2 cut(s)	4, 399
BmgT120I	GGNCC	4 cut(s)	4, 139, 342, 399
BmiI	GGNNCC	3 cut(s)	6, 141, 376
BmrFI	CCNGG	2 cut(s)	194, 346
BmsI	GCATC	1 cut(s)	338
BplI	GAGNNNNNCTC	2 cut(s)	247, 279
BpmI	CTGGAG	1 cut(s)	21
Bpu10I	CCTNAGC	3 cut(s)	55, 132, 302
BpuMI	CCSGG	1 cut(s)	194
BsaI	GGTCTC	1 cut(s)	267
BsaJI	CCNNGG	1 cut(s)	345
Bsc4I	CCNNNNNNNGG	3 cut(s)	233, 278, 408
Bse3DI	GCAATG	3 cut(s)	221, 296, 468
BseBI	CCWGG	1 cut(s)	346
BseDI	CCNNGG	1 cut(s)	345
BseGI	GGATG	1 cut(s)	130
BseLI	CCNNNNNNNGG	3 cut(s)	233, 278, 408
BseMI	GCAATG	3 cut(s)	221, 296, 468
BseMII	CTCAG	3 cut(s)	69, 123, 352
BseRI	GAGGAG	1 cut(s)	149
BseXI	GCAGC	3 cut(s)	34, 84, 262
BseYI	CCCAGC	1 cut(s)	278
BshFI	GGCC	2 cut(s)	140, 344
BshNI	GGYRCC	1 cut(s)	374
BsiSI	CCGG	2 cut(s)	178, 193
BslFI	GGGAC	1 cut(s)	295
BslI	CCNNNNNNNGG	3 cut(s)	233, 278, 408
BsmAI	GTCTC	1 cut(s)	267
BsmFI	GGGAC	1 cut(s)	295
BsnI	GGCC	2 cut(s)	140, 344
Bso31I	GGTCTC	1 cut(s)	267
Bsp1286I	GDGCHC	1 cut(s)	227
BspANI	GGCC	2 cut(s)	140, 344
BspCNI	CTCAG	3 cut(s)	68, 124, 351
BspLI	GGNNCC	3 cut(s)	6, 141, 376
BspT107I	GGYRCC	1 cut(s)	374
BspTNI	GGTCTC	1 cut(s)	267
BsrDI	GCAATG	3 cut(s)	221, 296, 468
BssECI	CCNNGG	1 cut(s)	345
Bst2UI	CCWGG	1 cut(s)	346
Bst6I	CTCTTC	1 cut(s)	15
BstDEI	CTNAG	7 cut(s)	55, 101, 132, 247, 285, 302, 338
BstF5I	GGATG	1 cut(s)	130
BstMAI	GTCTC	1 cut(s)	267
BstMWI	GCNNNNNNNGC	4 cut(s)	47, 56, 137, 243
BstNI	CCWGG	1 cut(s)	346
BstNSI	RCATGY	1 cut(s)	74
BstSCI	CCNGG	2 cut(s)	192, 344
BstV1I	GCAGC	3 cut(s)	34, 84, 262
BsuRI	GGCC	2 cut(s)	140, 344
BtsCI	GGATG	1 cut(s)	130
CaiI	CAGNNNCTG	1 cut(s)	44
Cfr13I	GGNCC	4 cut(s)	4, 139, 342, 399
CviAII	CATG	4 cut(s)	71, 320, 390, 427
CviJI	RGCY	9 cut(s)	41, 59, 97, 131, 140, 225, 246, 344, 413
CviKI_1	RGCY	9 cut(s)	41, 59, 97, 131, 140, 225, 246, 344, 413
DdeI	CTNAG	7 cut(s)	55, 101, 132, 247, 285, 302, 338
Eam1104I	CTCTTC	1 cut(s)	15
EarI	CTCTTC	1 cut(s)	15
Eco24I	GRGCYC	1 cut(s)	227
Eco31I	GGTCTC	1 cut(s)	267
Eco32I	GATATC	1 cut(s)	352
Eco47I	GGWCC	2 cut(s)	4, 399
EcoO109I	RGGNCCY	1 cut(s)	139
EcoRII	CCWGG	1 cut(s)	344
EcoRV	GATATC	1 cut(s)	352
EcoT38I	GRGCYC	1 cut(s)	227
FaeI	CATG	4 cut(s)	74, 323, 393, 430
FaiI	YATR	5 cut(s)	72, 321, 391, 404, 428
FalI	AAGNNNNNCTT	4 cut(s)	230, 262, 353, 385
FaqI	GGGAC	1 cut(s)	295
FatI	CATG	4 cut(s)	70, 319, 389, 426
Fnu4HI	GCNGC	3 cut(s)	48, 98, 276
FokI	GGATG	1 cut(s)	137
FriOI	GRGCYC	1 cut(s)	227
Fsp4HI	GCNGC	3 cut(s)	48, 98, 276
FspBI	CTAG	2 cut(s)	60, 475
GluI	GCNGC	3 cut(s)	48, 98, 276
GsaI	CCCAGC	1 cut(s)	282
GsuI	CTGGAG	1 cut(s)	21
HaeIII	GGCC	2 cut(s)	140, 344
HapII	CCGG	2 cut(s)	178, 193
Hin1II	CATG	4 cut(s)	74, 323, 393, 430
HinfI	GANTC	2 cut(s)	116, 160
HpaII	CCGG	2 cut(s)	178, 193
HphI	GGTGA	1 cut(s)	215
Hpy166II	GTNNAC	1 cut(s)	76
Hpy188I	TCNGA	1 cut(s)	91
Hpy188III	TCNNGA	1 cut(s)	355
Hpy8I	GTNNAC	1 cut(s)	76
HpyAV	CCTTC	4 cut(s)	200, 252, 390, 401
HpyF10VI	GCNNNNNNNGC	4 cut(s)	47, 56, 137, 243
HpyF3I	CTNAG	7 cut(s)	55, 101, 132, 247, 285, 302, 338
Hsp92II	CATG	4 cut(s)	74, 323, 393, 430
LmnI	GCTCC	2 cut(s)	46, 211
Lsp1109I	GCAGC	3 cut(s)	34, 84, 262
LweI	GCATC	1 cut(s)	338
MaeI	CTAG	2 cut(s)	60, 475
MaeIII	GTNAC	1 cut(s)	464
MhlI	GDGCHC	1 cut(s)	227
MmeI	TCCRAC	3 cut(s)	44, 50, 56
MnlI	CCTC	6 cut(s)	18, 64, 97, 121, 127, 130
MspI	CCGG	2 cut(s)	178, 193
MspR9I	CCNGG	2 cut(s)	194, 346
MvaI	CCWGG	1 cut(s)	346
MwoI	GCNNNNNNNGC	4 cut(s)	47, 56, 137, 243
NciI	CCSGG	1 cut(s)	194
NlaIII	CATG	4 cut(s)	74, 323, 393, 430
NlaIV	GGNNCC	3 cut(s)	6, 141, 376
NmuCI	GTSAC	1 cut(s)	464
NspI	RCATGY	1 cut(s)	74
PciI	ACATGT	1 cut(s)	70
PfeI	GAWTC	2 cut(s)	116, 160
PflMI	CCANNNNNTGG	1 cut(s)	233
PkrI	GCNGC	3 cut(s)	49, 99, 277
PscI	ACATGT	1 cut(s)	70
Psp6I	CCWGG	1 cut(s)	344
PspFI	CCCAGC	1 cut(s)	278
PspGI	CCWGG	1 cut(s)	344
PspN4I	GGNNCC	3 cut(s)	6, 141, 376
PspPI	GGNCC	4 cut(s)	4, 139, 342, 399
PstNI	CAGNNNCTG	1 cut(s)	44
SatI	GCNGC	3 cut(s)	48, 98, 276
Sau96I	GGNCC	4 cut(s)	4, 139, 342, 399
ScrFI	CCNGG	2 cut(s)	194, 346
SduI	GDGCHC	1 cut(s)	227
SetI	ASST	7 cut(s)	43, 56, 61, 99, 248, 263, 423
SfaNI	GCATC	1 cut(s)	338
SinI	GGWCC	2 cut(s)	4, 399
SspMI	CTAG	2 cut(s)	60, 475
StyD4I	CCNGG	2 cut(s)	192, 344
TaqI	TCGA	1 cut(s)	170
TfiI	GAWTC	2 cut(s)	116, 160
TseFI	GTSAC	1 cut(s)	464
TseI	GCWGC	3 cut(s)	47, 97, 275
Tsp45I	GTSAC	1 cut(s)	464
TspDTI	ATGAA	2 cut(s)	308, 415
Van91I	CCANNNNNTGG	1 cut(s)	233
VpaK11BI	GGWCC	2 cut(s)	4, 399
XceI	RCATGY	1 cut(s)	74
XspI	CTAG	2 cut(s)	60, 475

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.