Prupe.8G269600_v2.0.a1

Cotton fibre expressed protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0016068
Physical Location & Seq
Forward (+)
22407172 .. 22408204
1033 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G269600.1

Sequence Viewer

Length: 627 bp
ATGATGAAGATGTCCAACAAATCTATTAATGGTGATCATCATCATCATCGTCATCCTGATGTGGGTCGTAGAGCATGGAAGCTGCTGCGTCTGGCATTGCTTTGGGCAAGAAAAGGCGGTGTCTTCAGACGACGCCTCATGATGGAACTGCGGGTCGTCCCCAACTTCCTCAAGAGCCTTGCTCATCATCATCATCATCGCAATGATAATCAATATTACTTTGAGCGTCAGCTGTCCTTCGACAAGACCCCCATTTTCCCCACCCTCAAAATGAACCGGCGAACATCCTCCTCCTCCATGCGCTTCATTAATATCCCTTGCTTAAACCCACCATTAGTGCTGGATTTTGATGATCATCATGAAGTCGACATGATCATTAATAATCATGATCAATTAGATGATGAAGATGATGATGATGATGAGGGAATGATAACTGAAGATAGTAATACTATTAATGTGCATGAAGAAAAGGGATGTGCAGATTATGAGGACGAATTGGTTGATATAAAGGCGGATGAGTTCATAGCTAAATTCTATCAGCAAATTAAGCTCCAAAGACAGATTTCATACCTACACTACTCCTCTAGTACTACTATACACTCAGACGCATGCTTAATTAATATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF761

Protein Analysis

209

Amino Acids

24.62

Weight (kDa)

6.12

Isoelectric Point (pI)

52.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016068)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G02170 AT5G38700
fragaria_vesca FvH4_5g39610
malus_domestica MD03G1297400.v1.1 MD11G1317200.v1.1
prunus_persica Prupe.8G269600_v2.0.a1
pyrus_communis pycom03g23590 pycom11g27680
rosa_chinensis RchiOBHm_Chr7g0241911
rosa_laevigata RLG00000000530
rosa_multiflora Rmu_ssc0000315.1_g000001
rosa_roxburghii Rroxscaffold_3G00218490
rosa_rugosa Rorug07G0348600
rosa_samantha Rh7DG488200
rosa_wichuraiana Rw7G042510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 366
AciI CCGC 3 cut(s) 117, 151, 512
AcsI RAATTY 1 cut(s) 530
AcuI CTGAAG 2 cut(s) 109, 456
AcyI GRCGYC 1 cut(s) 133
AfaI GTAC 1 cut(s) 589
AfiI CCNNNNNNNGG 2 cut(s) 62, 142
AluBI AGCT 4 cut(s) 82, 232, 527, 550
AluI AGCT 4 cut(s) 82, 232, 527, 550
ApeKI GCWGC 2 cut(s) 82, 85
ApoI RAATTY 1 cut(s) 530
AseI ATTAAT 5 cut(s) 27, 309, 378, 453, 618
AspLEI GCGC 1 cut(s) 303
AsuHPI GGTGA 1 cut(s) 44
BbsI GAAGAC 1 cut(s) 115
BbvI GCAGC 2 cut(s) 69, 72
BccI CCATC 1 cut(s) 136
BclI TGATCA 4 cut(s) 34, 352, 372, 388
BfaI CTAG 1 cut(s) 585
BisI GCNGC 2 cut(s) 83, 86
BlsI GCNGC 2 cut(s) 84, 87
BmcAI AGTACT 1 cut(s) 589
BpiI GAAGAC 1 cut(s) 115
BplI GAGNNNNNCTC 2 cut(s) 166, 198
BpuEI CTTGAG 1 cut(s) 155
BsaBI GATNNNNATC 2 cut(s) 39, 354
BsaHI GRCGYC 1 cut(s) 133
Bsc4I CCNNNNNNNGG 2 cut(s) 62, 142
Bse118I RCCGGY 1 cut(s) 276
Bse3DI GCAATG 2 cut(s) 95, 208
Bse8I GATNNNNATC 2 cut(s) 39, 354
BseGI GGATG 4 cut(s) 52, 284, 479, 520
BseJI GATNNNNATC 2 cut(s) 39, 354
BseLI CCNNNNNNNGG 2 cut(s) 62, 142
BseMI GCAATG 2 cut(s) 95, 208
BseMII CTCAG 1 cut(s) 615
BseRI GAGGAG 3 cut(s) 280, 283, 571
BseXI GCAGC 2 cut(s) 69, 72
BsgI GTGCAG 1 cut(s) 498
BsiSI CCGG 1 cut(s) 277
BslFI GGGAC 1 cut(s) 143
BslI CCNNNNNNNGG 2 cut(s) 62, 142
BsmFI GGGAC 1 cut(s) 143
Bsp143I GATC 4 cut(s) 34, 352, 372, 388
BspACI CCGC 3 cut(s) 117, 151, 512
BspCNI CTCAG 1 cut(s) 614
BspHI TCATGA 3 cut(s) 138, 358, 385
BsrDI GCAATG 2 cut(s) 95, 208
BsrFI RCCGGY 1 cut(s) 276
BssAI RCCGGY 1 cut(s) 276
BssMI GATC 4 cut(s) 34, 352, 372, 388
BssNI GRCGYC 1 cut(s) 133
BstACI GRCGYC 1 cut(s) 133
BstC8I GCNNGC 1 cut(s) 610
BstDEI CTNAG 1 cut(s) 601
BstF5I GGATG 4 cut(s) 52, 284, 479, 520
BstHHI GCGC 1 cut(s) 303
BstKTI GATC 4 cut(s) 37, 355, 375, 391
BstMBI GATC 4 cut(s) 34, 352, 372, 388
BstMWI GCNNNNNNNGC 1 cut(s) 547
BstNSI RCATGY 1 cut(s) 612
BstV1I GCAGC 2 cut(s) 69, 72
BstV2I GAAGAC 1 cut(s) 115
BtgZI GCGATG 1 cut(s) 182
BtsCI GGATG 4 cut(s) 52, 284, 479, 520
Cac8I GCNNGC 1 cut(s) 610
CciI TCATGA 3 cut(s) 138, 358, 385
CfoI GCGC 1 cut(s) 303
Cfr10I RCCGGY 1 cut(s) 276
CseI GACGC 4 cut(s) 77, 141, 215, 614
Csp6I GTAC 1 cut(s) 588
CviAII CATG 8 cut(s) 75, 139, 298, 359, 370, 386, 461, 609
CviJI RGCY 5 cut(s) 82, 177, 232, 527, 550
CviKI_1 RGCY 5 cut(s) 82, 177, 232, 527, 550
CviQI GTAC 1 cut(s) 588
DdeI CTNAG 1 cut(s) 601
DpnI GATC 4 cut(s) 36, 354, 374, 390
DpnII GATC 4 cut(s) 34, 352, 372, 388
EciI GGCGGA 1 cut(s) 527
Eco57I CTGAAG 2 cut(s) 109, 456
FaeI CATG 8 cut(s) 78, 142, 301, 362, 373, 389, 464, 612
FaqI GGGAC 1 cut(s) 143
FatI CATG 8 cut(s) 74, 138, 297, 358, 369, 385, 460, 608
FauI CCCGC 1 cut(s) 144
FbaI TGATCA 4 cut(s) 34, 352, 372, 388
FblI GTMKAC 1 cut(s) 366
Fnu4HI GCNGC 2 cut(s) 83, 86
FokI GGATG 4 cut(s) 39, 271, 486, 527
Fsp4HI GCNGC 2 cut(s) 83, 86
FspBI CTAG 1 cut(s) 585
GlaI GCGC 1 cut(s) 302
GluI GCNGC 2 cut(s) 83, 86
HapII CCGG 1 cut(s) 277
HgaI GACGC 4 cut(s) 77, 141, 215, 614
HhaI GCGC 1 cut(s) 303
Hin1I GRCGYC 1 cut(s) 133
Hin1II CATG 8 cut(s) 78, 142, 301, 362, 373, 389, 464, 612
Hin6I GCGC 1 cut(s) 301
HinP1I GCGC 1 cut(s) 301
HincII GTYRAC 1 cut(s) 367
HindII GTYRAC 1 cut(s) 367
HpaII CCGG 1 cut(s) 277
HphI GGTGA 1 cut(s) 44
Hpy166II GTNNAC 1 cut(s) 367
Hpy188I TCNGA 2 cut(s) 128, 604
Hpy188III TCNNGA 5 cut(s) 56, 139, 172, 359, 386
Hpy8I GTNNAC 1 cut(s) 367
Hpy99I CGWCG 1 cut(s) 135
HpyAV CCTTC 1 cut(s) 247
HpyCH4V TGCA 2 cut(s) 460, 479
HpyF10VI GCNNNNNNNGC 1 cut(s) 547
HpyF3I CTNAG 1 cut(s) 601
Hsp92I GRCGYC 1 cut(s) 133
Hsp92II CATG 8 cut(s) 78, 142, 301, 362, 373, 389, 464, 612
HspAI GCGC 1 cut(s) 301
Ksp22I TGATCA 4 cut(s) 34, 352, 372, 388
Kzo9I GATC 4 cut(s) 34, 352, 372, 388
LmnI GCTCC 1 cut(s) 555
LpnPI CCDG 4 cut(s) 69, 77, 290, 326
Lsp1109I GCAGC 2 cut(s) 69, 72
MaeI CTAG 1 cut(s) 585
MalI GATC 4 cut(s) 36, 354, 374, 390
MboI GATC 4 cut(s) 34, 352, 372, 388
MboII GAAGA 5 cut(s) 19, 115, 416, 449, 476
MluCI AATT 5 cut(s) 392, 494, 530, 543, 615
MmeI TCCRAC 1 cut(s) 39
MnlI CCTC 9 cut(s) 146, 179, 275, 298, 301, 304, 415, 481, 592
MseI TTAA 8 cut(s) 27, 309, 323, 378, 453, 546, 614, 618
MslI CAYNNNNRTG 2 cut(s) 57, 201
MspA1I CMGCKG 1 cut(s) 232
MspI CCGG 1 cut(s) 277
MwoI GCNNNNNNNGC 1 cut(s) 547
NdeII GATC 4 cut(s) 34, 352, 372, 388
NlaIII CATG 8 cut(s) 78, 142, 301, 362, 373, 389, 464, 612
NspI RCATGY 1 cut(s) 612
PacI TTAATTAA 1 cut(s) 618
PaeI GCATGC 1 cut(s) 612
PagI TCATGA 3 cut(s) 138, 358, 385
PkrI GCNGC 2 cut(s) 84, 87
PshBI ATTAAT 5 cut(s) 27, 309, 378, 453, 618
PvuII CAGCTG 1 cut(s) 232
RsaI GTAC 1 cut(s) 589
RsaNI GTAC 1 cut(s) 588
RseI CAYNNNNRTG 2 cut(s) 57, 201
SalI GTCGAC 1 cut(s) 365
SaqAI TTAA 8 cut(s) 27, 309, 323, 378, 453, 546, 614, 618
SatI GCNGC 2 cut(s) 83, 86
Sau3AI GATC 4 cut(s) 34, 352, 372, 388
ScaI AGTACT 1 cut(s) 589
SetI ASST 5 cut(s) 84, 234, 529, 552, 573
SmiMI CAYNNNNRTG 2 cut(s) 57, 201
SmlI CTYRAG 1 cut(s) 170
SmoI CTYRAG 1 cut(s) 170
SphI GCATGC 1 cut(s) 612
Sse9I AATT 5 cut(s) 392, 494, 530, 543, 615
SsiI CCGC 3 cut(s) 117, 151, 512
SspI AATATT 1 cut(s) 215
SspMI CTAG 1 cut(s) 585
TaqI TCGA 2 cut(s) 240, 366
TasI AATT 5 cut(s) 392, 494, 530, 543, 615
TatI WGTACW 1 cut(s) 587
Tru1I TTAA 8 cut(s) 27, 309, 323, 378, 453, 546, 614, 618
Tru9I TTAA 8 cut(s) 27, 309, 323, 378, 453, 546, 614, 618
TseI GCWGC 2 cut(s) 82, 85
TspDTI ATGAA 8 cut(s) 20, 287, 295, 375, 417, 477, 511, 555
VspI ATTAAT 5 cut(s) 27, 309, 378, 453, 618
XapI RAATTY 1 cut(s) 530
XceI RCATGY 1 cut(s) 612
XmiI GTMKAC 1 cut(s) 366
XspI CTAG 1 cut(s) 585
ZrmI AGTACT 1 cut(s) 589
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.