pycom02g11840

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Reverse (-)
8396818 .. 8397540
723 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g11840.2

Sequence Viewer

Length: 285 bp
ATGAGTTTGAATTTGTTTTCCATTTTATCTATTTTTTATGGGTTTGTAATTTTTAACTATGGTGATATCTTGCAGGAGGCAGCCAAGTATGTGGTGAATACAAAGAATATAGAAGAAGCAATGAGCATTTTCACAGAGACCTGGTTTGGTACTGAGGTGATTCTGAAAAAAGCTGCTATCAAAAAAAGCTGGGAGCTGTTTTTGTGTTTGGTAAACACTCAGCTTCAGCTTTTTTTCACAGTTTTGGATGAAAAAAAGCCAAAAACAAGAAGCTGCAAAACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.9

Weight (kDa)

8.58

Isoelectric Point (pI)

55.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 10
AcuI CTGAAG 1 cut(s) 209
AfaI GTAC 1 cut(s) 151
AgsI TTSAA 1 cut(s) 10
AjnI CCWGG 1 cut(s) 140
AluBI AGCT 6 cut(s) 173, 189, 196, 223, 229, 273
AluI AGCT 6 cut(s) 173, 189, 196, 223, 229, 273
Alw26I GTCTC 1 cut(s) 131
ApeKI GCWGC 3 cut(s) 80, 173, 273
ApoI RAATTY 1 cut(s) 10
AsuHPI GGTGA 3 cut(s) 74, 106, 169
BaeI ACNNNNGTAYC 2 cut(s) 141, 174
BbvI GCAGC 3 cut(s) 92, 160, 260
BciT130I CCWGG 1 cut(s) 142
BcoDI GTCTC 1 cut(s) 131
BfaI CTAG 1 cut(s) 283
BisI GCNGC 3 cut(s) 81, 174, 274
BlsI GCNGC 3 cut(s) 82, 175, 275
Bme1390I CCNGG 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 142
BsaI GGTCTC 1 cut(s) 131
Bse3DI GCAATG 1 cut(s) 126
BseBI CCWGG 1 cut(s) 142
BseGI GGATG 1 cut(s) 253
BseMI GCAATG 1 cut(s) 126
BseMII CTCAG 2 cut(s) 144, 233
BseXI GCAGC 3 cut(s) 92, 160, 260
BseYI CCCAGC 1 cut(s) 189
BsmAI GTCTC 1 cut(s) 131
Bso31I GGTCTC 1 cut(s) 131
BspCNI CTCAG 2 cut(s) 145, 232
BspTNI GGTCTC 1 cut(s) 131
BsrDI GCAATG 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 142
Bst4CI ACNGT 1 cut(s) 241
BstDEI CTNAG 2 cut(s) 153, 219
BstF5I GGATG 1 cut(s) 253
BstMAI GTCTC 1 cut(s) 131
BstNI CCWGG 1 cut(s) 142
BstSCI CCNGG 1 cut(s) 140
BstV1I GCAGC 3 cut(s) 92, 160, 260
BstXI CCANNNNNNTGG 1 cut(s) 91
BtsCI GGATG 1 cut(s) 253
CsiI ACCWGGT 1 cut(s) 140
Csp6I GTAC 1 cut(s) 150
CviJI RGCY 8 cut(s) 83, 173, 189, 196, 223, 229, 259, 273
CviKI_1 RGCY 8 cut(s) 83, 173, 189, 196, 223, 229, 259, 273
CviQI GTAC 1 cut(s) 150
DdeI CTNAG 2 cut(s) 153, 219
Eco31I GGTCTC 1 cut(s) 131
Eco32I GATATC 1 cut(s) 67
Eco57I CTGAAG 1 cut(s) 209
EcoRII CCWGG 1 cut(s) 140
EcoRV GATATC 1 cut(s) 67
FaiI YATR 4 cut(s) 39, 60, 90, 110
Fnu4HI GCNGC 3 cut(s) 81, 174, 274
FokI GGATG 1 cut(s) 260
Fsp4HI GCNGC 3 cut(s) 81, 174, 274
FspBI CTAG 1 cut(s) 283
GluI GCNGC 3 cut(s) 81, 174, 274
GsaI CCCAGC 1 cut(s) 193
HinfI GANTC 1 cut(s) 160
HphI GGTGA 3 cut(s) 74, 106, 169
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 1 cut(s) 165
Hpy8I GTNNAC 1 cut(s) 214
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4V TGCA 2 cut(s) 73, 276
HpyF3I CTNAG 2 cut(s) 153, 219
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 4 cut(s) 59, 127, 154, 175
Lsp1109I GCAGC 3 cut(s) 92, 160, 260
MabI ACCWGGT 1 cut(s) 140
MaeI CTAG 1 cut(s) 283
MboII GAAGA 1 cut(s) 125
MluCI AATT 2 cut(s) 10, 48
MnlI CCTC 2 cut(s) 70, 148
MseI TTAA 1 cut(s) 54
MspR9I CCNGG 1 cut(s) 142
MvaI CCWGG 1 cut(s) 142
PfeI GAWTC 1 cut(s) 160
PkrI GCNGC 3 cut(s) 82, 175, 275
Psp6I CCWGG 1 cut(s) 140
PspFI CCCAGC 1 cut(s) 189
PspGI CCWGG 1 cut(s) 140
RsaI GTAC 1 cut(s) 151
RsaNI GTAC 1 cut(s) 150
SaqAI TTAA 1 cut(s) 54
SatI GCNGC 3 cut(s) 81, 174, 274
ScrFI CCNGG 1 cut(s) 142
SetI ASST 9 cut(s) 143, 159, 175, 191, 198, 225, 231, 275, 284
SexAI ACCWGGT 1 cut(s) 140
SgeI CNNG 7 cut(s) 82, 86, 97, 153, 154, 202, 279
Sse9I AATT 2 cut(s) 10, 48
SspMI CTAG 1 cut(s) 283
StyD4I CCNGG 1 cut(s) 140
TaaI ACNGT 1 cut(s) 241
TasI AATT 2 cut(s) 10, 48
TfiI GAWTC 1 cut(s) 160
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TseI GCWGC 3 cut(s) 80, 173, 273
TspDTI ATGAA 1 cut(s) 264
XapI RAATTY 1 cut(s) 10
XspI CTAG 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.