pycom12g13500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0012671
Physical Location & Seq
Reverse (-)
15979637 .. 15980363
727 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g13500.2

Sequence Viewer

Length: 210 bp
ATGGTGTTCCAGATCGGCACCGACGCCCATCTCTACGAGGATCCCCACGACGTCAGCACCTGGTTTGGTACTGAGGTGATTCTGAAAAAAGCTGGTATCAAAAAAAGTTGGGAGCTGTTTTTGTGTTTGGTAAACATTCAGCTTCCGCTTTTTTTCACAGTTTTGGGTGAAAAAAAGCCAAAAACAAGAAGCTGCAAAACCCAGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.94

Weight (kDa)

8.66

Isoelectric Point (pI)

27.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 54
AccB1I GGYRCC 1 cut(s) 17
AciI CCGC 1 cut(s) 146
AclWI GGATC 2 cut(s) 35, 48
AcyI GRCGYC 2 cut(s) 24, 51
AfaI GTAC 1 cut(s) 70
AjnI CCWGG 1 cut(s) 59
AluBI AGCT 5 cut(s) 92, 115, 142, 192, 205
AluI AGCT 5 cut(s) 92, 115, 142, 192, 205
AlwI GGATC 2 cut(s) 35, 48
AlwNI CAGNNNCTG 1 cut(s) 60
ApeKI GCWGC 1 cut(s) 192
AsuHPI GGTGA 2 cut(s) 88, 179
BaeI ACNNNNGTAYC 2 cut(s) 60, 93
BamHI GGATCC 1 cut(s) 40
BanI GGYRCC 1 cut(s) 17
BbvI GCAGC 1 cut(s) 179
BccI CCATC 1 cut(s) 36
BciT130I CCWGG 1 cut(s) 61
BisI GCNGC 1 cut(s) 193
BlsI GCNGC 1 cut(s) 194
Bme1390I CCNGG 1 cut(s) 61
BmiI GGNNCC 2 cut(s) 19, 42
BmrFI CCNGG 1 cut(s) 61
BsaHI GRCGYC 2 cut(s) 24, 51
BseBI CCWGG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 63
BseXI GCAGC 1 cut(s) 179
BseYI CCCAGC 1 cut(s) 201
BshNI GGYRCC 1 cut(s) 17
Bsp143I GATC 2 cut(s) 12, 40
BspACI CCGC 1 cut(s) 146
BspCNI CTCAG 1 cut(s) 64
BspLI GGNNCC 2 cut(s) 19, 42
BspPI GGATC 2 cut(s) 35, 48
BspT107I GGYRCC 1 cut(s) 17
BssMI GATC 2 cut(s) 12, 40
BssNI GRCGYC 2 cut(s) 24, 51
Bst2UI CCWGG 1 cut(s) 61
Bst4CI ACNGT 1 cut(s) 160
BstACI GRCGYC 2 cut(s) 24, 51
BstDEI CTNAG 1 cut(s) 72
BstKTI GATC 2 cut(s) 15, 43
BstMBI GATC 2 cut(s) 12, 40
BstNI CCWGG 1 cut(s) 61
BstSCI CCNGG 1 cut(s) 59
BstV1I GCAGC 1 cut(s) 179
BstX2I RGATCY 1 cut(s) 40
BstYI RGATCY 1 cut(s) 40
CaiI CAGNNNCTG 1 cut(s) 60
CseI GACGC 1 cut(s) 32
CsiI ACCWGGT 1 cut(s) 59
Csp6I GTAC 1 cut(s) 69
CviJI RGCY 6 cut(s) 92, 115, 142, 178, 192, 205
CviKI_1 RGCY 6 cut(s) 92, 115, 142, 178, 192, 205
CviQI GTAC 1 cut(s) 69
DdeI CTNAG 1 cut(s) 72
DpnI GATC 2 cut(s) 14, 42
DpnII GATC 2 cut(s) 12, 40
EcoRII CCWGG 1 cut(s) 59
Fnu4HI GCNGC 1 cut(s) 193
Fsp4HI GCNGC 1 cut(s) 193
GluI GCNGC 1 cut(s) 193
GsaI CCCAGC 1 cut(s) 205
HgaI GACGC 1 cut(s) 32
Hin1I GRCGYC 2 cut(s) 24, 51
HinfI GANTC 1 cut(s) 79
HphI GGTGA 2 cut(s) 88, 179
Hpy166II GTNNAC 1 cut(s) 133
Hpy188I TCNGA 1 cut(s) 84
Hpy188III TCNNGA 1 cut(s) 10
Hpy8I GTNNAC 1 cut(s) 133
Hpy99I CGWCG 2 cut(s) 26, 53
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4IV ACGT 1 cut(s) 51
HpyCH4V TGCA 1 cut(s) 195
HpyF3I CTNAG 1 cut(s) 72
HpySE526I ACGT 1 cut(s) 51
Hsp92I GRCGYC 2 cut(s) 24, 51
Kzo9I GATC 2 cut(s) 12, 40
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 4 cut(s) 23, 46, 73, 78
Lsp1109I GCAGC 1 cut(s) 179
MabI ACCWGGT 1 cut(s) 59
MaeII ACGT 1 cut(s) 51
MalI GATC 2 cut(s) 14, 42
MboI GATC 2 cut(s) 12, 40
MflI RGATCY 1 cut(s) 40
MnlI CCTC 2 cut(s) 31, 67
MspR9I CCNGG 1 cut(s) 61
MvaI CCWGG 1 cut(s) 61
NdeII GATC 2 cut(s) 12, 40
NlaIV GGNNCC 2 cut(s) 19, 42
PfeI GAWTC 1 cut(s) 79
PkrI GCNGC 1 cut(s) 194
Psp6I CCWGG 1 cut(s) 59
PspFI CCCAGC 1 cut(s) 201
PspGI CCWGG 1 cut(s) 59
PspN4I GGNNCC 2 cut(s) 19, 42
PstNI CAGNNNCTG 1 cut(s) 60
PsuI RGATCY 1 cut(s) 40
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
SatI GCNGC 1 cut(s) 193
Sau3AI GATC 2 cut(s) 12, 40
ScrFI CCNGG 1 cut(s) 61
SetI ASST 8 cut(s) 54, 62, 78, 94, 117, 144, 194, 207
SexAI ACCWGGT 1 cut(s) 59
SgeI CNNG 7 cut(s) 22, 49, 59, 72, 73, 105, 198
SsiI CCGC 1 cut(s) 146
StyD4I CCNGG 1 cut(s) 59
TaaI ACNGT 1 cut(s) 160
TaiI ACGT 1 cut(s) 54
TfiI GAWTC 1 cut(s) 79
TseI GCWGC 1 cut(s) 192
ZraI GACGTC 1 cut(s) 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.