pycom07g19170

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0012671
Physical Location & Seq
Reverse (-)
21488348 .. 21489304
957 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g19170.3

Sequence Viewer

Length: 351 bp
ATGATAAGGTTCAATGGACTTCTCGCGACGTCGTGGGCAGCGAACCACCCACGCCGCCGCGATCCGAACAATTCACCAGACCATTCAATCGGTAGGAGCGACGGGCAGTGTGTACAAAGGAAACCAATTTTAGTAAAAATACAAATAAATTCTGAAATTCAAAATATTTTCTTTAAAAACACTTTTAGTAAGTACAAGACTACGACCTGGTTTGGTACTGAGGTGATTCTGAAAAAAGCTGCTATCAAAAAAAGCTGGGAGCTGTTTTTGTGTTTGGTAAACACTCAGCTTCAGCTTTTTTTCACAGTTTTGGATGAAAAAAAGCCAAAAACAAGAAGCTGCAAAACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

13.47

Weight (kDa)

10.14

Isoelectric Point (pI)

36.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 32
AccII CGCG 2 cut(s) 26, 60
AciI CCGC 2 cut(s) 55, 58
AclWI GGATC 1 cut(s) 56
AcsI RAATTY 2 cut(s) 148, 156
AcuI CTGAAG 1 cut(s) 275
AcyI GRCGYC 1 cut(s) 29
AfaI GTAC 3 cut(s) 114, 194, 217
AgsI TTSAA 3 cut(s) 13, 87, 161
AjnI CCWGG 1 cut(s) 206
AluBI AGCT 6 cut(s) 239, 255, 262, 289, 295, 339
AluI AGCT 6 cut(s) 239, 255, 262, 289, 295, 339
AlwI GGATC 1 cut(s) 56
ApeKI GCWGC 3 cut(s) 38, 239, 339
ApoI RAATTY 2 cut(s) 148, 156
AsuHPI GGTGA 2 cut(s) 66, 235
BaeI ACNNNNGTAYC 2 cut(s) 207, 240
BbvI GCAGC 3 cut(s) 50, 226, 326
BciT130I CCWGG 1 cut(s) 208
BfaI CTAG 1 cut(s) 349
BisI GCNGC 5 cut(s) 39, 55, 58, 240, 340
BlsI GCNGC 5 cut(s) 40, 56, 59, 241, 341
Bme1390I CCNGG 1 cut(s) 208
BmrFI CCNGG 1 cut(s) 208
BsaHI GRCGYC 1 cut(s) 29
BseBI CCWGG 1 cut(s) 208
BseGI GGATG 1 cut(s) 319
BseMII CTCAG 2 cut(s) 210, 299
BseXI GCAGC 3 cut(s) 50, 226, 326
BseYI CCCAGC 1 cut(s) 255
Bsh1236I CGCG 2 cut(s) 26, 60
Bsp1407I TGTACA 1 cut(s) 112
Bsp143I GATC 1 cut(s) 61
Bsp68I TCGCGA 1 cut(s) 26
BspACI CCGC 2 cut(s) 55, 58
BspCNI CTCAG 2 cut(s) 211, 298
BspFNI CGCG 2 cut(s) 26, 60
BspPI GGATC 1 cut(s) 56
BsrGI TGTACA 1 cut(s) 112
BssMI GATC 1 cut(s) 61
BssNI GRCGYC 1 cut(s) 29
Bst2UI CCWGG 1 cut(s) 208
Bst4CI ACNGT 1 cut(s) 307
BstACI GRCGYC 1 cut(s) 29
BstAUI TGTACA 1 cut(s) 112
BstDEI CTNAG 2 cut(s) 219, 285
BstF5I GGATG 1 cut(s) 319
BstFNI CGCG 2 cut(s) 26, 60
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
BstNI CCWGG 1 cut(s) 208
BstSCI CCNGG 1 cut(s) 206
BstUI CGCG 2 cut(s) 26, 60
BstV1I GCAGC 3 cut(s) 50, 226, 326
BtsCI GGATG 1 cut(s) 319
BtsI GCAGTG 1 cut(s) 113
BtsIMutI CAGTG 1 cut(s) 113
BtuMI TCGCGA 1 cut(s) 26
CsiI ACCWGGT 1 cut(s) 206
Csp6I GTAC 3 cut(s) 113, 193, 216
CviJI RGCY 7 cut(s) 239, 255, 262, 289, 295, 325, 339
CviKI_1 RGCY 7 cut(s) 239, 255, 262, 289, 295, 325, 339
CviQI GTAC 3 cut(s) 113, 193, 216
DdeI CTNAG 2 cut(s) 219, 285
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
DraI TTTAAA 1 cut(s) 175
Eco57I CTGAAG 1 cut(s) 275
EcoRII CCWGG 1 cut(s) 206
Fnu4HI GCNGC 5 cut(s) 39, 55, 58, 240, 340
FokI GGATG 1 cut(s) 326
Fsp4HI GCNGC 5 cut(s) 39, 55, 58, 240, 340
FspBI CTAG 1 cut(s) 349
GluI GCNGC 5 cut(s) 39, 55, 58, 240, 340
GsaI CCCAGC 1 cut(s) 259
Hin1I GRCGYC 1 cut(s) 29
HinfI GANTC 1 cut(s) 226
HphI GGTGA 2 cut(s) 66, 235
Hpy166II GTNNAC 2 cut(s) 113, 280
Hpy188I TCNGA 3 cut(s) 66, 154, 231
Hpy188III TCNNGA 1 cut(s) 25
Hpy8I GTNNAC 2 cut(s) 113, 280
Hpy99I CGWCG 3 cut(s) 31, 34, 104
HpyCH4III ACNGT 1 cut(s) 307
HpyCH4IV ACGT 1 cut(s) 29
HpyCH4V TGCA 1 cut(s) 342
HpyF3I CTNAG 2 cut(s) 219, 285
HpySE526I ACGT 1 cut(s) 29
Hsp92I GRCGYC 1 cut(s) 29
Kzo9I GATC 1 cut(s) 61
LmnI GCTCC 2 cut(s) 96, 259
LpnPI CCDG 4 cut(s) 90, 193, 220, 241
Lsp1109I GCAGC 3 cut(s) 50, 226, 326
MabI ACCWGGT 1 cut(s) 206
MaeI CTAG 1 cut(s) 349
MaeII ACGT 1 cut(s) 29
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MluCI AATT 4 cut(s) 70, 126, 148, 156
MnlI CCTC 1 cut(s) 214
MseI TTAA 1 cut(s) 174
MspR9I CCNGG 1 cut(s) 208
MvaI CCWGG 1 cut(s) 208
MvnI CGCG 2 cut(s) 26, 60
NdeII GATC 1 cut(s) 61
NruI TCGCGA 1 cut(s) 26
PcsI WCGNNNNNNNCGW 2 cut(s) 38, 96
PfeI GAWTC 1 cut(s) 226
PkrI GCNGC 5 cut(s) 40, 56, 59, 241, 341
Psp6I CCWGG 1 cut(s) 206
PspFI CCCAGC 1 cut(s) 255
PspGI CCWGG 1 cut(s) 206
RruI TCGCGA 1 cut(s) 26
RsaI GTAC 3 cut(s) 114, 194, 217
RsaNI GTAC 3 cut(s) 113, 193, 216
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 5 cut(s) 39, 55, 58, 240, 340
Sau3AI GATC 1 cut(s) 61
ScrFI CCNGG 1 cut(s) 208
SexAI ACCWGGT 1 cut(s) 206
Sse9I AATT 4 cut(s) 70, 126, 148, 156
SsiI CCGC 2 cut(s) 55, 58
SspI AATATT 1 cut(s) 166
SspMI CTAG 1 cut(s) 349
StyD4I CCNGG 1 cut(s) 206
TaaI ACNGT 1 cut(s) 307
TaiI ACGT 1 cut(s) 32
TasI AATT 4 cut(s) 70, 126, 148, 156
TatI WGTACW 2 cut(s) 112, 192
TauI GCSGC 2 cut(s) 57, 60
TfiI GAWTC 1 cut(s) 226
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TscAI CASTG 1 cut(s) 113
TseI GCWGC 3 cut(s) 38, 239, 339
TspDTI ATGAA 1 cut(s) 330
TspRI CASTG 1 cut(s) 113
XapI RAATTY 2 cut(s) 148, 156
XspI CTAG 1 cut(s) 349
ZraI GACGTC 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.