pycom04g15630

V-type proton ATPase subunit

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Forward (+)
18457823 .. 18458200
378 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g15630.1

Sequence Viewer

Length: 249 bp
ATGAACGATGCAGATGTGTCGAAGCAGATTCAGCAGATGGTCAGATTCATTCGCCAAGAGGCTGAAGAGAAAGCCAATGAGATTTCTGTCTCTGCTGAGGAGACCTGGTTTGGTACTGAGGTGATTCTGAAAAAAGCTGCTATAAAAAAAAGCTGGGAGCTGTTTTTGTGTTTGGTAAACACTCAGCTTCAGCTTTTTTTTACAGTTTTGGATGAAAAAAAGCCAAAAACAAGAAGCTGCAAAACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

9.54

Weight (kDa)

7.74

Isoelectric Point (pI)

41.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 84, 173
AfaI GTAC 1 cut(s) 115
AjnI CCWGG 1 cut(s) 104
AluBI AGCT 6 cut(s) 137, 153, 160, 187, 193, 237
AluI AGCT 6 cut(s) 137, 153, 160, 187, 193, 237
Alw26I GTCTC 2 cut(s) 94, 95
ApeKI GCWGC 2 cut(s) 137, 237
AsuHPI GGTGA 1 cut(s) 133
BaeI ACNNNNGTAYC 2 cut(s) 105, 138
BbvCI CCTCAGC 1 cut(s) 96
BbvI GCAGC 2 cut(s) 124, 224
BccI CCATC 1 cut(s) 31
BcgI CGANNNNNNTGC 1 cut(s) 34
BciT130I CCWGG 1 cut(s) 106
BcoDI GTCTC 2 cut(s) 94, 95
BfaI CTAG 1 cut(s) 247
BisI GCNGC 2 cut(s) 138, 238
BlsI GCNGC 2 cut(s) 139, 239
Bme1390I CCNGG 1 cut(s) 106
BmrFI CCNGG 1 cut(s) 106
Bpu10I CCTNAGC 1 cut(s) 96
BsaI GGTCTC 1 cut(s) 95
BsaXI ACNNNNNCTCC 2 cut(s) 92, 122
BseBI CCWGG 1 cut(s) 106
BseGI GGATG 1 cut(s) 217
BseMII CTCAG 3 cut(s) 87, 108, 197
BseRI GAGGAG 1 cut(s) 113
BseXI GCAGC 2 cut(s) 124, 224
BseYI CCCAGC 1 cut(s) 153
BsmAI GTCTC 2 cut(s) 94, 95
Bso31I GGTCTC 1 cut(s) 95
BspCNI CTCAG 3 cut(s) 88, 109, 196
BspTNI GGTCTC 1 cut(s) 95
Bst2UI CCWGG 1 cut(s) 106
Bst4CI ACNGT 1 cut(s) 205
Bst6I CTCTTC 1 cut(s) 60
BstDEI CTNAG 3 cut(s) 96, 117, 183
BstF5I GGATG 1 cut(s) 217
BstMAI GTCTC 2 cut(s) 94, 95
BstMWI GCNNNNNNNGC 1 cut(s) 31
BstNI CCWGG 1 cut(s) 106
BstSCI CCNGG 1 cut(s) 104
BstV1I GCAGC 2 cut(s) 124, 224
BtsCI GGATG 1 cut(s) 217
CsiI ACCWGGT 1 cut(s) 104
Csp6I GTAC 1 cut(s) 114
CviJI RGCY 9 cut(s) 62, 74, 137, 153, 160, 187, 193, 223, 237
CviKI_1 RGCY 9 cut(s) 62, 74, 137, 153, 160, 187, 193, 223, 237
CviQI GTAC 1 cut(s) 114
DdeI CTNAG 3 cut(s) 96, 117, 183
Eam1104I CTCTTC 1 cut(s) 60
EarI CTCTTC 1 cut(s) 60
Eco31I GGTCTC 1 cut(s) 95
Eco57I CTGAAG 2 cut(s) 84, 173
EcoRII CCWGG 1 cut(s) 104
FaiI YATR 1 cut(s) 143
Fnu4HI GCNGC 2 cut(s) 138, 238
FokI GGATG 1 cut(s) 224
Fsp4HI GCNGC 2 cut(s) 138, 238
FspBI CTAG 1 cut(s) 247
GluI GCNGC 2 cut(s) 138, 238
GsaI CCCAGC 1 cut(s) 157
HinfI GANTC 3 cut(s) 28, 45, 124
HphI GGTGA 1 cut(s) 133
Hpy166II GTNNAC 1 cut(s) 178
Hpy188I TCNGA 2 cut(s) 44, 129
Hpy8I GTNNAC 1 cut(s) 178
HpyCH4III ACNGT 1 cut(s) 205
HpyCH4V TGCA 2 cut(s) 11, 240
HpyF10VI GCNNNNNNNGC 1 cut(s) 31
HpyF3I CTNAG 3 cut(s) 96, 117, 183
LmnI GCTCC 1 cut(s) 157
LpnPI CCDG 3 cut(s) 91, 118, 139
Lsp1109I GCAGC 2 cut(s) 124, 224
MabI ACCWGGT 1 cut(s) 104
MaeI CTAG 1 cut(s) 247
MboII GAAGA 1 cut(s) 77
MnlI CCTC 3 cut(s) 52, 91, 112
MspR9I CCNGG 1 cut(s) 106
MvaI CCWGG 1 cut(s) 106
MwoI GCNNNNNNNGC 1 cut(s) 31
PfeI GAWTC 3 cut(s) 28, 45, 124
PkrI GCNGC 2 cut(s) 139, 239
Psp6I CCWGG 1 cut(s) 104
PspFI CCCAGC 1 cut(s) 153
PspGI CCWGG 1 cut(s) 104
RsaI GTAC 1 cut(s) 115
RsaNI GTAC 1 cut(s) 114
SatI GCNGC 2 cut(s) 138, 238
ScrFI CCNGG 1 cut(s) 106
SetI ASST 9 cut(s) 107, 123, 139, 155, 162, 189, 195, 239, 248
SexAI ACCWGGT 1 cut(s) 104
SgeI CNNG 5 cut(s) 68, 117, 118, 166, 243
SspMI CTAG 1 cut(s) 247
StyD4I CCNGG 1 cut(s) 104
TaaI ACNGT 1 cut(s) 205
TaqI TCGA 1 cut(s) 20
TfiI GAWTC 3 cut(s) 28, 45, 124
TseI GCWGC 2 cut(s) 137, 237
TspDTI ATGAA 3 cut(s) 17, 37, 228
XspI CTAG 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.