pycom04g19590

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
Physical Location & Seq
Forward (+)
21287318 .. 21287587
270 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g19590.1

Sequence Viewer

Length: 270 bp
ATGGCGTCAAATAAAAAAAGAAAACTCGAAAATCAGACGGACAGTAAGGAAACAAATGAAGAACGCCAATTAGAAGATGATATCATCGGCGAAATCCTCCGTTTCCTTCCCACTAAGACCTGGTTTGGTACTGAGGTGATTCTGAAAAAAGCTGCTATAAAAAAAAGCTGGGAGCTGTTTTTGTGTTTGGTAAACACTCAGCTTCAGCTTTTTTTCACAGTTTTGGGTGAAAAAAAGCCAAAAACAAGAAGCTACAAAACCCAGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.48

Weight (kDa)

9.48

Isoelectric Point (pI)

38.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 188
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 1 cut(s) 130
AjnI CCWGG 1 cut(s) 119
AluBI AGCT 7 cut(s) 152, 168, 175, 202, 208, 252, 265
AluI AGCT 7 cut(s) 152, 168, 175, 202, 208, 252, 265
ApeKI GCWGC 1 cut(s) 152
AsuHPI GGTGA 2 cut(s) 148, 239
BaeI ACNNNNGTAYC 2 cut(s) 120, 153
BbvI GCAGC 1 cut(s) 139
BciT130I CCWGG 1 cut(s) 121
BisI GCNGC 1 cut(s) 153
BlsI GCNGC 1 cut(s) 154
Bme1390I CCNGG 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 121
BsaHI GRCGYC 1 cut(s) 5
BseBI CCWGG 1 cut(s) 121
BseMII CTCAG 2 cut(s) 123, 212
BseXI GCAGC 1 cut(s) 139
BseYI CCCAGC 2 cut(s) 168, 261
BspCNI CTCAG 2 cut(s) 124, 211
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 121
Bst4CI ACNGT 2 cut(s) 44, 220
BstACI GRCGYC 1 cut(s) 5
BstDEI CTNAG 3 cut(s) 114, 132, 198
BstNI CCWGG 1 cut(s) 121
BstSCI CCNGG 1 cut(s) 119
BstV1I GCAGC 1 cut(s) 139
CsiI ACCWGGT 1 cut(s) 119
Csp6I GTAC 1 cut(s) 129
CviJI RGCY 8 cut(s) 152, 168, 175, 202, 208, 238, 252, 265
CviKI_1 RGCY 8 cut(s) 152, 168, 175, 202, 208, 238, 252, 265
CviQI GTAC 1 cut(s) 129
DdeI CTNAG 3 cut(s) 114, 132, 198
Eco32I GATATC 1 cut(s) 82
Eco57I CTGAAG 1 cut(s) 188
EcoRII CCWGG 1 cut(s) 119
EcoRV GATATC 1 cut(s) 82
FaiI YATR 1 cut(s) 158
Fnu4HI GCNGC 1 cut(s) 153
Fsp4HI GCNGC 1 cut(s) 153
GluI GCNGC 1 cut(s) 153
GsaI CCCAGC 2 cut(s) 172, 265
Hin1I GRCGYC 1 cut(s) 5
HinfI GANTC 1 cut(s) 139
HphI GGTGA 2 cut(s) 148, 239
Hpy166II GTNNAC 1 cut(s) 193
Hpy188I TCNGA 2 cut(s) 36, 144
Hpy8I GTNNAC 1 cut(s) 193
HpyAV CCTTC 1 cut(s) 116
HpyCH4III ACNGT 2 cut(s) 44, 220
HpyF3I CTNAG 3 cut(s) 114, 132, 198
Hsp92I GRCGYC 1 cut(s) 5
LmnI GCTCC 1 cut(s) 172
LpnPI CCDG 3 cut(s) 106, 133, 154
Lsp1109I GCAGC 1 cut(s) 139
MabI ACCWGGT 1 cut(s) 119
MboII GAAGA 2 cut(s) 71, 86
MluCI AATT 1 cut(s) 68
MnlI CCTC 2 cut(s) 107, 127
MspR9I CCNGG 1 cut(s) 121
MvaI CCWGG 1 cut(s) 121
PfeI GAWTC 1 cut(s) 139
PkrI GCNGC 1 cut(s) 154
Psp6I CCWGG 1 cut(s) 119
PspFI CCCAGC 2 cut(s) 168, 261
PspGI CCWGG 1 cut(s) 119
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SatI GCNGC 1 cut(s) 153
ScrFI CCNGG 1 cut(s) 121
SetI ASST 9 cut(s) 122, 138, 154, 170, 177, 204, 210, 254, 267
SexAI ACCWGGT 1 cut(s) 119
SgeI CNNG 5 cut(s) 38, 132, 133, 181, 258
Sse9I AATT 1 cut(s) 68
StyD4I CCNGG 1 cut(s) 119
TaaI ACNGT 2 cut(s) 44, 220
TaqI TCGA 1 cut(s) 27
TasI AATT 1 cut(s) 68
TfiI GAWTC 1 cut(s) 139
TseI GCWGC 1 cut(s) 152
TspDTI ATGAA 1 cut(s) 72
TspGWI ACGGA 2 cut(s) 53, 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.