pycom06g00070

Pectate lyase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
Physical Location & Seq
Forward (+)
65708 .. 65971
264 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g00070.1

Sequence Viewer

Length: 264 bp
ATGACCAACAACGTAGGAAGCCATGTCACATTCTATCAAGTCACCGATCCGAGTGACAATGCATTACACCCAAATCCAGGAACTTTGAGATATGGAGCTACCATGATCAAAGGGAAAAAGTGGATCACTTTCCAGAGGGACATGCGAATTAAACTTGACAAACCACTGCTCATTAGTAGCTTCACTGCCGTTGATGGAAGAGGCGCTAATGTTCACATTGCCGGGAATGCATGCTTGACGGTCTTTTTAAGGCAAGCAACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

9.59

Weight (kDa)

9.89

Isoelectric Point (pI)

17.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 41, 131
AfiI CCNNNNNNNGG 1 cut(s) 77
AjnI CCWGG 1 cut(s) 76
AluBI AGCT 2 cut(s) 98, 180
AluI AGCT 2 cut(s) 98, 180
AlwI GGATC 2 cut(s) 41, 131
AspLEI GCGC 1 cut(s) 206
AsuC2I CCSGG 1 cut(s) 223
AsuHPI GGTGA 1 cut(s) 34
BccI CCATC 1 cut(s) 188
BceAI ACGGC 1 cut(s) 173
BciT130I CCWGG 1 cut(s) 78
BclI TGATCA 1 cut(s) 105
BcnI CCSGG 1 cut(s) 223
BfoI RGCGCY 1 cut(s) 207
Bme1390I CCNGG 2 cut(s) 78, 223
BmrFI CCNGG 2 cut(s) 78, 223
BpuMI CCSGG 1 cut(s) 223
Bsc4I CCNNNNNNNGG 1 cut(s) 77
Bse3DI GCAATG 1 cut(s) 216
BseBI CCWGG 1 cut(s) 78
BseLI CCNNNNNNNGG 1 cut(s) 77
BseMI GCAATG 1 cut(s) 216
BsiSI CCGG 1 cut(s) 222
BslFI GGGAC 1 cut(s) 152
BslI CCNNNNNNNGG 1 cut(s) 77
BsmFI GGGAC 1 cut(s) 152
BsmI GAATGC 1 cut(s) 232
Bsp143I GATC 3 cut(s) 46, 105, 123
BspPI GGATC 2 cut(s) 41, 131
BsrDI GCAATG 1 cut(s) 216
BssMI GATC 3 cut(s) 46, 105, 123
Bst2UI CCWGG 1 cut(s) 78
Bst4CI ACNGT 1 cut(s) 241
Bst6I CTCTTC 1 cut(s) 193
BstC8I GCNNGC 2 cut(s) 232, 255
BstH2I RGCGCY 1 cut(s) 207
BstHHI GCGC 1 cut(s) 206
BstKTI GATC 3 cut(s) 49, 108, 126
BstMBI GATC 3 cut(s) 46, 105, 123
BstMWI GCNNNNNNNGC 1 cut(s) 227
BstNI CCWGG 1 cut(s) 78
BstNSI RCATGY 2 cut(s) 145, 234
BstSCI CCNGG 2 cut(s) 76, 221
BtsI GCAGTG 2 cut(s) 164, 183
BtsIMutI CAGTG 2 cut(s) 164, 183
Cac8I GCNNGC 2 cut(s) 232, 255
CfoI GCGC 1 cut(s) 206
CviAII CATG 4 cut(s) 23, 103, 142, 231
CviJI RGCY 3 cut(s) 21, 98, 180
CviKI_1 RGCY 3 cut(s) 21, 98, 180
DpnI GATC 3 cut(s) 48, 107, 125
DpnII GATC 3 cut(s) 46, 105, 123
Eam1104I CTCTTC 1 cut(s) 193
EarI CTCTTC 1 cut(s) 193
EcoRII CCWGG 1 cut(s) 76
EcoT22I ATGCAT 2 cut(s) 64, 232
FaeI CATG 4 cut(s) 26, 106, 145, 234
FaiI YATR 6 cut(s) 24, 93, 104, 143, 232, 262
FaqI GGGAC 1 cut(s) 152
FatI CATG 4 cut(s) 22, 102, 141, 230
FbaI TGATCA 1 cut(s) 105
GlaI GCGC 1 cut(s) 205
HaeII RGCGCY 1 cut(s) 207
HapII CCGG 1 cut(s) 222
HhaI GCGC 1 cut(s) 206
Hin1II CATG 4 cut(s) 26, 106, 145, 234
Hin6I GCGC 1 cut(s) 204
HinP1I GCGC 1 cut(s) 204
HpaII CCGG 1 cut(s) 222
HphI GGTGA 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 1 cut(s) 51
Hpy188III TCNNGA 1 cut(s) 133
Hpy8I GTNNAC 1 cut(s) 214
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4IV ACGT 1 cut(s) 12
HpyCH4V TGCA 2 cut(s) 62, 230
HpyF10VI GCNNNNNNNGC 1 cut(s) 227
HpySE526I ACGT 1 cut(s) 12
Hsp92II CATG 4 cut(s) 26, 106, 145, 234
HspAI GCGC 1 cut(s) 204
Ksp22I TGATCA 1 cut(s) 105
Kzo9I GATC 3 cut(s) 46, 105, 123
LmnI GCTCC 1 cut(s) 95
LpnPI CCDG 4 cut(s) 63, 90, 146, 235
MaeII ACGT 1 cut(s) 12
MaeIII GTNAC 3 cut(s) 25, 40, 53
MalI GATC 3 cut(s) 48, 107, 125
MboI GATC 3 cut(s) 46, 105, 123
MboII GAAGA 1 cut(s) 210
MluCI AATT 1 cut(s) 147
MnlI CCTC 2 cut(s) 129, 194
Mph1103I ATGCAT 2 cut(s) 64, 232
MseI TTAA 2 cut(s) 150, 248
MspI CCGG 1 cut(s) 222
MspR9I CCNGG 2 cut(s) 78, 223
Mva1269I GAATGC 1 cut(s) 232
MvaI CCWGG 1 cut(s) 78
MwoI GCNNNNNNNGC 1 cut(s) 227
NciI CCSGG 1 cut(s) 223
NdeII GATC 3 cut(s) 46, 105, 123
NlaIII CATG 4 cut(s) 26, 106, 145, 234
NmuCI GTSAC 3 cut(s) 25, 40, 53
NsiI ATGCAT 2 cut(s) 64, 232
NspI RCATGY 2 cut(s) 145, 234
PaeI GCATGC 1 cut(s) 234
PctI GAATGC 1 cut(s) 232
PfoI TCCNGGA 1 cut(s) 76
Psp6I CCWGG 1 cut(s) 76
PspGI CCWGG 1 cut(s) 76
SaqAI TTAA 2 cut(s) 150, 248
Sau3AI GATC 3 cut(s) 46, 105, 123
ScrFI CCNGG 2 cut(s) 78, 223
SetI ASST 3 cut(s) 15, 100, 182
SphI GCATGC 1 cut(s) 234
Sse9I AATT 1 cut(s) 147
StyD4I CCNGG 2 cut(s) 76, 221
TaaI ACNGT 1 cut(s) 241
TaiI ACGT 1 cut(s) 15
TasI AATT 1 cut(s) 147
Tru1I TTAA 2 cut(s) 150, 248
Tru9I TTAA 2 cut(s) 150, 248
TscAI CASTG 2 cut(s) 171, 190
TseFI GTSAC 3 cut(s) 25, 40, 53
Tsp45I GTSAC 3 cut(s) 25, 40, 53
TspRI CASTG 2 cut(s) 171, 190
XceI RCATGY 2 cut(s) 145, 234
Zsp2I ATGCAT 2 cut(s) 64, 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.