pycom06g02820

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
OG0008718
Physical Location & Seq
Forward (+)
3438746 .. 3439210
465 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g02820.1

Sequence Viewer

Length: 465 bp
ATGAAGCCTATCGATCAAAGAGAGCGCACCAGAAACCGTAATGATATTCAGACAAGTCGCATGAAGAACAGAGAACGACAGCGTAGGTATAGGGCCCGTAAGCGTCTTGAAGCAGATTTGAAGAAATCTAGCATCATAAAGCAACCAACTACACCAGAAGTAGAAGTGCAACGAAATGAGTTCATTTACACACCCCGTGTGTACTGTAAACGAGATTGGAAAAAGGATGCAAGGAGTGCTCATGCTTTTAAGGCCCCTGAATTTACGCATAATGGTTATGCCATCCCTACTCTTTCGTCAATCAGTGAGGGTCAAAGCGTGTTTTTGTCTGGACCCATGGCAGAGCTACAATTAGATAGTGAATCCCGGTCTGAGATAATTGTGAACCAGAATAACTGCGAAATGCATGTATCTAACTTTGGTCGAAGAGATTGGAAAGCTGATGCAAGAAAGAAGAAAATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

155

Amino Acids

18.23

Weight (kDa)

10.18

Isoelectric Point (pI)

50.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 260
AdeI CACNNNGTG 1 cut(s) 197
AfaI GTAC 1 cut(s) 203
AgsI TTSAA 2 cut(s) 110, 121
AluBI AGCT 2 cut(s) 346, 440
AluI AGCT 2 cut(s) 346, 440
Alw21I GWGCWC 1 cut(s) 241
AoxI GGCC 2 cut(s) 93, 252
ApaI GGGCCC 1 cut(s) 97
ApoI RAATTY 1 cut(s) 260
AspLEI GCGC 1 cut(s) 27
AspS9I GGNCC 4 cut(s) 93, 94, 253, 332
AsuC2I CCSGG 1 cut(s) 367
AvaII GGWCC 1 cut(s) 332
BaeGI GKGCMC 1 cut(s) 97
BanII GRGCYC 1 cut(s) 97
Bbv12I GWGCWC 1 cut(s) 241
BccI CCATC 1 cut(s) 290
BcnI CCSGG 1 cut(s) 367
BfaI CTAG 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 367
Bme18I GGWCC 1 cut(s) 332
BmgT120I GGNCC 4 cut(s) 93, 94, 253, 332
BmiI GGNNCC 3 cut(s) 95, 255, 334
BmrFI CCNGG 1 cut(s) 367
BmsI GCATC 3 cut(s) 141, 217, 433
BpuMI CCSGG 1 cut(s) 367
Bsa29I ATCGAT 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 336
BseCI ATCGAT 1 cut(s) 12
BseDI CCNNGG 1 cut(s) 336
BseGI GGATG 2 cut(s) 232, 282
BseMII CTCAG 1 cut(s) 363
BseSI GKGCMC 1 cut(s) 97
BshFI GGCC 2 cut(s) 95, 254
BshVI ATCGAT 1 cut(s) 12
BsiHKAI GWGCWC 1 cut(s) 241
BsiSI CCGG 1 cut(s) 367
BsnI GGCC 2 cut(s) 95, 254
Bsp120I GGGCCC 1 cut(s) 93
Bsp1286I GDGCHC 2 cut(s) 97, 241
Bsp143I GATC 1 cut(s) 13
Bsp19I CCATGG 1 cut(s) 336
BspANI GGCC 2 cut(s) 95, 254
BspCNI CTCAG 1 cut(s) 364
BspDI ATCGAT 1 cut(s) 12
BspLI GGNNCC 3 cut(s) 95, 255, 334
BssECI CCNNGG 1 cut(s) 336
BssMI GATC 1 cut(s) 13
BssT1I CCWWGG 1 cut(s) 336
Bst4CI ACNGT 2 cut(s) 38, 206
Bst6I CTCTTC 1 cut(s) 421
BstAPI GCANNNNNTGC 1 cut(s) 236
BstDEI CTNAG 1 cut(s) 372
BstDSI CCRYGG 1 cut(s) 336
BstF5I GGATG 2 cut(s) 232, 282
BstHHI GCGC 1 cut(s) 27
BstKTI GATC 1 cut(s) 16
BstMBI GATC 1 cut(s) 13
BstMWI GCNNNNNNNGC 2 cut(s) 236, 251
BstNSI RCATGY 1 cut(s) 410
BstSCI CCNGG 1 cut(s) 365
BstSLI GKGCMC 1 cut(s) 97
Bsu15I ATCGAT 1 cut(s) 12
BsuRI GGCC 2 cut(s) 95, 254
BsuTUI ATCGAT 1 cut(s) 12
BtgI CCRYGG 1 cut(s) 336
BtsCI GGATG 2 cut(s) 232, 282
BtsIMutI CAGTG 1 cut(s) 310
CfoI GCGC 1 cut(s) 27
Cfr13I GGNCC 4 cut(s) 93, 94, 253, 332
ClaI ATCGAT 1 cut(s) 12
CseI GACGC 1 cut(s) 92
Csp6I GTAC 1 cut(s) 202
CviAII CATG 4 cut(s) 61, 242, 337, 407
CviJI RGCY 5 cut(s) 7, 95, 254, 346, 440
CviKI_1 RGCY 5 cut(s) 7, 95, 254, 346, 440
CviQI GTAC 1 cut(s) 202
DdeI CTNAG 1 cut(s) 372
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
DraIII CACNNNGTG 1 cut(s) 197
Eam1104I CTCTTC 1 cut(s) 421
EarI CTCTTC 1 cut(s) 421
Eco130I CCWWGG 1 cut(s) 336
Eco24I GRGCYC 1 cut(s) 97
Eco47I GGWCC 1 cut(s) 332
EcoO109I RGGNCCY 2 cut(s) 93, 253
EcoT14I CCWWGG 1 cut(s) 336
EcoT22I ATGCAT 1 cut(s) 408
EcoT38I GRGCYC 1 cut(s) 97
ErhI CCWWGG 1 cut(s) 336
FaeI CATG 4 cut(s) 64, 245, 340, 410
FaiI YATR 8 cut(s) 62, 90, 137, 243, 270, 279, 338, 408
FatI CATG 4 cut(s) 60, 241, 336, 406
FokI GGATG 2 cut(s) 239, 269
FriOI GRGCYC 1 cut(s) 97
FspBI CTAG 1 cut(s) 129
GlaI GCGC 1 cut(s) 26
HaeIII GGCC 2 cut(s) 95, 254
HapII CCGG 1 cut(s) 367
HgaI GACGC 1 cut(s) 92
HhaI GCGC 1 cut(s) 27
Hin1II CATG 4 cut(s) 64, 245, 340, 410
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HinfI GANTC 1 cut(s) 362
HpaII CCGG 1 cut(s) 367
Hpy166II GTNNAC 3 cut(s) 202, 209, 385
Hpy188I TCNGA 2 cut(s) 51, 373
Hpy188III TCNNGA 2 cut(s) 107, 330
Hpy8I GTNNAC 3 cut(s) 202, 209, 385
HpyCH4III ACNGT 2 cut(s) 38, 206
HpyCH4V TGCA 4 cut(s) 169, 230, 406, 446
HpyF10VI GCNNNNNNNGC 2 cut(s) 236, 251
HpyF3I CTNAG 1 cut(s) 372
Hsp92II CATG 4 cut(s) 64, 245, 340, 410
HspAI GCGC 1 cut(s) 25
Kzo9I GATC 1 cut(s) 13
LpnPI CCDG 6 cut(s) 43, 168, 270, 315, 380, 401
LweI GCATC 3 cut(s) 141, 217, 433
MaeI CTAG 1 cut(s) 129
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MboII GAAGA 3 cut(s) 76, 133, 438
MhlI GDGCHC 2 cut(s) 97, 241
MluCI AATT 3 cut(s) 260, 350, 378
MnlI CCTC 1 cut(s) 301
Mph1103I ATGCAT 1 cut(s) 408
MseI TTAA 1 cut(s) 249
MspI CCGG 1 cut(s) 367
MspR9I CCNGG 1 cut(s) 367
MwoI GCNNNNNNNGC 2 cut(s) 236, 251
NciI CCSGG 1 cut(s) 367
NcoI CCATGG 1 cut(s) 336
NdeII GATC 1 cut(s) 13
NlaIII CATG 4 cut(s) 64, 245, 340, 410
NlaIV GGNNCC 3 cut(s) 95, 255, 334
NsiI ATGCAT 1 cut(s) 408
NspI RCATGY 1 cut(s) 410
PfeI GAWTC 1 cut(s) 362
PspN4I GGNNCC 3 cut(s) 95, 255, 334
PspOMI GGGCCC 1 cut(s) 93
PspPI GGNCC 4 cut(s) 93, 94, 253, 332
RsaI GTAC 1 cut(s) 203
RsaNI GTAC 1 cut(s) 202
SaqAI TTAA 1 cut(s) 249
Sau3AI GATC 1 cut(s) 13
Sau96I GGNCC 4 cut(s) 93, 94, 253, 332
ScrFI CCNGG 1 cut(s) 367
SduI GDGCHC 2 cut(s) 97, 241
SetI ASST 3 cut(s) 89, 348, 442
SfaNI GCATC 3 cut(s) 141, 217, 433
SinI GGWCC 1 cut(s) 332
Sse9I AATT 3 cut(s) 260, 350, 378
SspMI CTAG 1 cut(s) 129
StyD4I CCNGG 1 cut(s) 365
StyI CCWWGG 1 cut(s) 336
TaaI ACNGT 2 cut(s) 38, 206
TaqI TCGA 2 cut(s) 12, 424
TasI AATT 3 cut(s) 260, 350, 378
TatI WGTACW 1 cut(s) 201
TfiI GAWTC 1 cut(s) 362
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TscAI CASTG 1 cut(s) 310
TspDTI ATGAA 3 cut(s) 17, 77, 172
TspRI CASTG 1 cut(s) 310
VpaK11BI GGWCC 1 cut(s) 332
XapI RAATTY 1 cut(s) 260
XceI RCATGY 1 cut(s) 410
XspI CTAG 1 cut(s) 129
Zsp2I ATGCAT 1 cut(s) 408
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.