pycom06g15470

50S ribosomal protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
OG0007928
Physical Location & Seq
Reverse (-)
19976712 .. 19976990
279 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g15470.1

Sequence Viewer

Length: 279 bp
ATGGACCTGGGTTCACAGGGAGGGGCAGCTGCTGGGTCAAAGGCTGAGGAAAAGAAGGTGGAGAAGACGGCTTTTGATGTGAAATTGGAGAAGTTCGATGCTGCTGCAAAAATCAAGGTGATCAAGGAAGTCAGGACTTTTACCAGTCTGGGATTGAAGGAGGCAAAAGATCTCGTCGAGAAGGTACCTTGTGTGCTTAAACAAGGGGTTACCAAAGAGGAAGCAAATGACATAATTGAGAAAATAAAGGCTGCTGGAGGAGTTGCTGTTATGGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L12

Protein Analysis

93

Amino Acids

9.78

Weight (kDa)

7.77

Isoelectric Point (pI)

21.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L12 PF00542 25 - 88 4.8e-23 Ribosomal protein L7/L12 C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 184
AccB1I GGYRCC 1 cut(s) 184
AfaI GTAC 1 cut(s) 186
AgsI TTSAA 1 cut(s) 157
AjnI CCWGG 1 cut(s) 6
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
AlwNI CAGNNNCTG 1 cut(s) 32
ApeKI GCWGC 5 cut(s) 26, 29, 101, 104, 251
Asp718I GGTACC 1 cut(s) 184
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 130
AvaII GGWCC 1 cut(s) 4
BanI GGYRCC 1 cut(s) 184
BbsI GAAGAC 1 cut(s) 71
BbvCI CCTCAGC 1 cut(s) 45
BbvI GCAGC 5 cut(s) 16, 38, 88, 91, 238
BceAI ACGGC 1 cut(s) 84
BcgI CGANNNNNNTGC 2 cut(s) 86, 120
BciT130I CCWGG 1 cut(s) 8
BclI TGATCA 1 cut(s) 120
BglII AGATCT 1 cut(s) 169
BisI GCNGC 5 cut(s) 27, 30, 102, 105, 252
BlsI GCNGC 5 cut(s) 28, 31, 103, 106, 253
Bme1390I CCNGG 1 cut(s) 8
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 186
BmrFI CCNGG 1 cut(s) 8
BmsI GCATC 1 cut(s) 88
BpiI GAAGAC 1 cut(s) 71
BpmI CTGGAG 1 cut(s) 276
Bpu10I CCTNAGC 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 7
BsaXI ACNNNNNCTCC 1 cut(s) 252
Bse1I ACTGG 1 cut(s) 144
BseBI CCWGG 1 cut(s) 8
BseDI CCNNGG 1 cut(s) 7
BseMII CTCAG 1 cut(s) 36
BseNI ACTGG 1 cut(s) 144
BseRI GAGGAG 1 cut(s) 273
BseXI GCAGC 5 cut(s) 16, 38, 88, 91, 238
BseYI CCCAGC 1 cut(s) 32
BshNI GGYRCC 1 cut(s) 184
Bsp143I GATC 2 cut(s) 120, 169
BspCNI CTCAG 1 cut(s) 37
BspLI GGNNCC 1 cut(s) 186
BspT107I GGYRCC 1 cut(s) 184
BsrI ACTGG 1 cut(s) 144
BssECI CCNNGG 1 cut(s) 7
BssMI GATC 2 cut(s) 120, 169
Bst2UI CCWGG 1 cut(s) 8
BstDEI CTNAG 1 cut(s) 45
BstEII GGTNACC 1 cut(s) 208
BstKTI GATC 2 cut(s) 123, 172
BstMBI GATC 2 cut(s) 120, 169
BstNI CCWGG 1 cut(s) 8
BstPI GGTNACC 1 cut(s) 208
BstSCI CCNGG 1 cut(s) 6
BstV1I GCAGC 5 cut(s) 16, 38, 88, 91, 238
BstV2I GAAGAC 1 cut(s) 71
BstX2I RGATCY 1 cut(s) 169
BstYI RGATCY 1 cut(s) 169
CaiI CAGNNNCTG 1 cut(s) 32
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 185
CviJI RGCY 4 cut(s) 29, 44, 71, 251
CviKI_1 RGCY 4 cut(s) 29, 44, 71, 251
CviQI GTAC 1 cut(s) 185
DdeI CTNAG 1 cut(s) 45
DpnI GATC 2 cut(s) 122, 171
DpnII GATC 2 cut(s) 120, 169
Eco47I GGWCC 1 cut(s) 4
Eco91I GGTNACC 1 cut(s) 208
EcoO65I GGTNACC 1 cut(s) 208
EcoRII CCWGG 1 cut(s) 6
FaiI YATR 2 cut(s) 233, 272
FbaI TGATCA 1 cut(s) 120
Fnu4HI GCNGC 5 cut(s) 27, 30, 102, 105, 252
Fsp4HI GCNGC 5 cut(s) 27, 30, 102, 105, 252
GluI GCNGC 5 cut(s) 27, 30, 102, 105, 252
GsaI CCCAGC 1 cut(s) 36
GsuI CTGGAG 1 cut(s) 276
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 1 cut(s) 14
Hpy188III TCNNGA 2 cut(s) 133, 178
Hpy8I GTNNAC 1 cut(s) 14
Hpy99I CGWCG 1 cut(s) 179
HpyAV CCTTC 3 cut(s) 49, 151, 175
HpyCH4V TGCA 1 cut(s) 107
HpyF3I CTNAG 1 cut(s) 45
KpnI GGTACC 1 cut(s) 188
Ksp22I TGATCA 1 cut(s) 120
Kzo9I GATC 2 cut(s) 120, 169
LpnPI CCDG 7 cut(s) 2, 18, 20, 118, 134, 157, 240
Lsp1109I GCAGC 5 cut(s) 16, 38, 88, 91, 238
LweI GCATC 1 cut(s) 88
MaeIII GTNAC 1 cut(s) 208
MalI GATC 2 cut(s) 122, 171
MboI GATC 2 cut(s) 120, 169
MboII GAAGA 1 cut(s) 76
MflI RGATCY 1 cut(s) 169
MluCI AATT 2 cut(s) 83, 234
MnlI CCTC 5 cut(s) 14, 40, 154, 211, 251
MseI TTAA 1 cut(s) 198
MspA1I CMGCKG 1 cut(s) 29
MspR9I CCNGG 1 cut(s) 8
MvaI CCWGG 1 cut(s) 8
NdeII GATC 2 cut(s) 120, 169
NlaIV GGNNCC 1 cut(s) 186
PkrI GCNGC 5 cut(s) 28, 31, 103, 106, 253
Psp6I CCWGG 1 cut(s) 6
PspEI GGTNACC 1 cut(s) 208
PspFI CCCAGC 1 cut(s) 32
PspGI CCWGG 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 186
PspPI GGNCC 1 cut(s) 4
PstNI CAGNNNCTG 1 cut(s) 32
PsuI RGATCY 1 cut(s) 169
PvuII CAGCTG 1 cut(s) 29
RsaI GTAC 1 cut(s) 186
RsaNI GTAC 1 cut(s) 185
SaqAI TTAA 1 cut(s) 198
SatI GCNGC 5 cut(s) 27, 30, 102, 105, 252
Sau3AI GATC 2 cut(s) 120, 169
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 8
SetI ASST 6 cut(s) 9, 31, 60, 120, 186, 190
SfaNI GCATC 1 cut(s) 88
SinI GGWCC 1 cut(s) 4
Sse9I AATT 2 cut(s) 83, 234
StyD4I CCNGG 1 cut(s) 6
TaqI TCGA 2 cut(s) 96, 177
TasI AATT 2 cut(s) 83, 234
Tru1I TTAA 1 cut(s) 198
Tru9I TTAA 1 cut(s) 198
TseI GCWGC 5 cut(s) 26, 29, 101, 104, 251
VpaK11BI GGWCC 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.