Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011510.1

Orthogroup ID

OG0007928

Physical Location & Seq

Genomic Coordinates Forward (+)

9575 .. 10156

Gene Structure 582 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011510.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 582 bp

atgaggatcattgcagttgccagatcttttcgtgctcgtcccacacgacctaaagcaactggtcatctgcaagttcgtgcgttccaacccgattttgttccgagggatcccaaggccaagtcgatacgctacaaatatccggaagtctataacccctatggccctagacccccaccctcggataaaattgttcagcttgctgaaagaattgcagctctggcccctgcagaacagtgtcaacttggtcctgcacttgtggagaagctaaagcttccgcagctgcagcccatatcaacagaaggcatggacttaggtccacagggaggggctgctggtgggtcaaaggctgaggagaagaaggttgagaaaactgcttttgatgtcaaattggagaagtttgaagcgtctgcaaaaatcaaggtgatcaaggaagtgagggcttttaccagtctcggattgaaggaggctaaagaacttgttgagaaggcaccttgtgtgcttaaacaagggcttaccaaagaggaagcaaatgacatgattgagaaactaaaggctgctggaggagttgctgttctggagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_L12

Protein Analysis

193

Amino Acids

21.07

Weight (kDa)

9.58

Isoelectric Point (pI)

31.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007928)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G03130 AT3G06040 AT3G06040 AT3G06040
fragaria_vesca	FvH4_5g05340 FvH4_5g05340
malus_domestica	MD06G1173500.v1.1 MD14G1180000.v1.1
prunus_persica	Prupe.5G173000_v2.0.a1 Prupe.5G173000_v2.0.a1 Prupe.5G173000_v2.0.a1
pyrus_communis	pycom06g15470 pycom14g14980
rosa_chinensis	RchiOBHm_Chr7g0193501
rosa_laevigata	RLG00000004266
rosa_multiflora	Rmu_co8169084.1_g000001 Rmu_sc0011510.1_g000006
rosa_roxburghii	Rroxscaffold_3G00262050
rosa_rugosa	Rorug07G0009800
rosa_samantha	Rh7AG136600 Rh7BG136900 Rh7CG140300 Rh7DG138100
rosa_wichuraiana	Rw7G011640

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	487
AccIII	TCCGGA	1 cut(s)	139
AciI	CCGC	1 cut(s)	275
AclWI	GGATC	3 cut(s)	14, 101, 114
AdeI	CACNNNGTG	1 cut(s)	494
AfiI	CCNNNNNNNGG	2 cut(s)	178, 323
AgsI	TTSAA	2 cut(s)	401, 460
AloI	GAACNNNNNNTCC	1 cut(s)	555
AluBI	AGCT	5 cut(s)	196, 215, 265, 271, 280
AluI	AGCT	5 cut(s)	196, 215, 265, 271, 280
Alw21I	GWGCWC	1 cut(s)	37
Alw26I	GTCTC	1 cut(s)	455
AlwI	GGATC	3 cut(s)	14, 101, 114
Aor13HI	TCCGGA	1 cut(s)	139
AoxI	GGCC	3 cut(s)	114, 160, 219
ApeKI	GCWGC	6 cut(s)	212, 277, 280, 283, 329, 554
AspS9I	GGNCC	4 cut(s)	161, 220, 245, 314
AsuHPI	GGTGA	1 cut(s)	433
AvaII	GGWCC	2 cut(s)	245, 314
BamHI	GGATCC	1 cut(s)	106
BanI	GGYRCC	1 cut(s)	487
Bbv12I	GWGCWC	1 cut(s)	37
BbvCI	CCTCAGC	1 cut(s)	348
BbvI	GCAGC	6 cut(s)	224, 267, 289, 295, 316, 541
BclI	TGATCA	1 cut(s)	423
BcoDI	GTCTC	1 cut(s)	455
BfaI	CTAG	1 cut(s)	165
BfmI	CTRYAG	2 cut(s)	225, 281
BglII	AGATCT	1 cut(s)	23
BisI	GCNGC	6 cut(s)	213, 278, 281, 284, 330, 555
BlsI	GCNGC	6 cut(s)	214, 279, 282, 285, 331, 556
Bme18I	GGWCC	2 cut(s)	245, 314
BmgT120I	GGNCC	4 cut(s)	161, 220, 245, 314
BmiI	GGNNCC	3 cut(s)	108, 222, 489
BoxI	GACNNNNGTC	1 cut(s)	312
BpmI	CTGGAG	1 cut(s)	579
Bpu10I	CCTNAGC	1 cut(s)	348
BsaJI	CCNNGG	3 cut(s)	101, 111, 177
BsaWI	WCCGGW	1 cut(s)	139
BsaXI	ACNNNNNCTCC	1 cut(s)	555
Bsc4I	CCNNNNNNNGG	2 cut(s)	178, 323
Bse1I	ACTGG	2 cut(s)	64, 447
Bse3DI	GCAATG	1 cut(s)	9
BseAI	TCCGGA	1 cut(s)	139
BseDI	CCNNGG	3 cut(s)	101, 111, 177
BseLI	CCNNNNNNNGG	2 cut(s)	178, 323
BseMI	GCAATG	1 cut(s)	9
BseMII	CTCAG	1 cut(s)	339
BseNI	ACTGG	2 cut(s)	64, 447
BseRI	GAGGAG	2 cut(s)	365, 576
BseXI	GCAGC	6 cut(s)	224, 267, 289, 295, 316, 541
BsgI	GTGCAG	1 cut(s)	234
BshFI	GGCC	3 cut(s)	116, 162, 221
BshNI	GGYRCC	1 cut(s)	487
BsiHKAI	GWGCWC	1 cut(s)	37
BsiSI	CCGG	1 cut(s)	140
BslFI	GGGAC	1 cut(s)	24
BslI	CCNNNNNNNGG	2 cut(s)	178, 323
BsmAI	GTCTC	1 cut(s)	455
BsmFI	GGGAC	1 cut(s)	24
BsnI	GGCC	3 cut(s)	116, 162, 221
Bsp1286I	GDGCHC	1 cut(s)	37
Bsp13I	TCCGGA	1 cut(s)	139
Bsp143I	GATC	4 cut(s)	6, 23, 106, 423
BspACI	CCGC	1 cut(s)	275
BspANI	GGCC	3 cut(s)	116, 162, 221
BspCNI	CTCAG	1 cut(s)	340
BspEI	TCCGGA	1 cut(s)	139
BspLI	GGNNCC	3 cut(s)	108, 222, 489
BspMAI	CTGCAG	2 cut(s)	229, 285
BspPI	GGATC	3 cut(s)	14, 101, 114
BspT107I	GGYRCC	1 cut(s)	487
BsrDI	GCAATG	1 cut(s)	9
BsrI	ACTGG	2 cut(s)	64, 447
BssECI	CCNNGG	3 cut(s)	101, 111, 177
BssMI	GATC	4 cut(s)	6, 23, 106, 423
BssT1I	CCWWGG	1 cut(s)	111
Bst4CI	ACNGT	1 cut(s)	234
BstC8I	GCNNGC	1 cut(s)	198
BstDEI	CTNAG	2 cut(s)	310, 348
BstKTI	GATC	4 cut(s)	9, 26, 109, 426
BstMAI	GTCTC	1 cut(s)	455
BstMBI	GATC	4 cut(s)	6, 23, 106, 423
BstMWI	GCNNNNNNNGC	3 cut(s)	218, 277, 283
BstPAI	GACNNNNGTC	1 cut(s)	312
BstSFI	CTRYAG	2 cut(s)	225, 281
BstV1I	GCAGC	6 cut(s)	224, 267, 289, 295, 316, 541
BstX2I	RGATCY	2 cut(s)	23, 106
BstYI	RGATCY	2 cut(s)	23, 106
BsuRI	GGCC	3 cut(s)	116, 162, 221
BtsIMutI	CAGTG	1 cut(s)	239
Cac8I	GCNNGC	1 cut(s)	198
Cfr13I	GGNCC	4 cut(s)	161, 220, 245, 314
CseI	GACGC	1 cut(s)	393
CviAII	CATG	2 cut(s)	304, 535
DdeI	CTNAG	2 cut(s)	310, 348
DpnI	GATC	4 cut(s)	8, 25, 108, 425
DpnII	GATC	4 cut(s)	6, 23, 106, 423
DraIII	CACNNNGTG	1 cut(s)	494
Eco130I	CCWWGG	1 cut(s)	111
Eco47I	GGWCC	2 cut(s)	245, 314
EcoT14I	CCWWGG	1 cut(s)	111
ErhI	CCWWGG	1 cut(s)	111
FaeI	CATG	2 cut(s)	307, 538
FaiI	YATR	5 cut(s)	150, 159, 290, 305, 536
FaqI	GGGAC	1 cut(s)	24
FatI	CATG	2 cut(s)	303, 534
FbaI	TGATCA	1 cut(s)	423
Fnu4HI	GCNGC	6 cut(s)	213, 278, 281, 284, 330, 555
Fsp4HI	GCNGC	6 cut(s)	213, 278, 281, 284, 330, 555
FspBI	CTAG	1 cut(s)	165
GluI	GCNGC	6 cut(s)	213, 278, 281, 284, 330, 555
GsuI	CTGGAG	1 cut(s)	579
HaeIII	GGCC	3 cut(s)	116, 162, 221
HapII	CCGG	1 cut(s)	140
HgaI	GACGC	1 cut(s)	393
Hin1II	CATG	2 cut(s)	307, 538
HincII	GTYRAC	1 cut(s)	239
HindII	GTYRAC	1 cut(s)	239
HindIII	AAGCTT	1 cut(s)	269
HpaII	CCGG	1 cut(s)	140
HphI	GGTGA	1 cut(s)	433
Hpy166II	GTNNAC	2 cut(s)	239, 317
Hpy188I	TCNGA	3 cut(s)	102, 181, 455
Hpy188III	TCNNGA	2 cut(s)	140, 575
Hpy8I	GTNNAC	2 cut(s)	239, 317
HpyAV	CCTTC	4 cut(s)	293, 352, 454, 478
HpyCH4III	ACNGT	1 cut(s)	234
HpyCH4V	TGCA	7 cut(s)	14, 70, 212, 227, 251, 283, 410
HpyF10VI	GCNNNNNNNGC	3 cut(s)	218, 277, 283
HpyF3I	CTNAG	2 cut(s)	310, 348
Hsp92II	CATG	2 cut(s)	307, 538
Kpn2I	TCCGGA	1 cut(s)	139
Ksp22I	TGATCA	1 cut(s)	423
Kzo9I	GATC	4 cut(s)	6, 23, 106, 423
Lsp1109I	GCAGC	6 cut(s)	224, 267, 289, 295, 316, 541
MaeI	CTAG	1 cut(s)	165
MalI	GATC	4 cut(s)	8, 25, 108, 425
MboI	GATC	4 cut(s)	6, 23, 106, 423
MboII	GAAGA	1 cut(s)	367
MflI	RGATCY	2 cut(s)	23, 106
MhlI	GDGCHC	1 cut(s)	37
MluCI	AATT	3 cut(s)	186, 207, 386
MmeI	TCCRAC	1 cut(s)	109
MnlI	CCTC	8 cut(s)	96, 187, 317, 343, 429, 457, 514, 554
MroI	TCCGGA	1 cut(s)	139
MseI	TTAA	1 cut(s)	501
MspA1I	CMGCKG	1 cut(s)	280
MspI	CCGG	1 cut(s)	140
MwoI	GCNNNNNNNGC	3 cut(s)	218, 277, 283
NdeII	GATC	4 cut(s)	6, 23, 106, 423
NlaIII	CATG	2 cut(s)	307, 538
NlaIV	GGNNCC	3 cut(s)	108, 222, 489
PcsI	WCGNNNNNNNCGW	1 cut(s)	43
PkrI	GCNGC	6 cut(s)	214, 279, 282, 285, 331, 556
PshAI	GACNNNNGTC	1 cut(s)	312
PspN4I	GGNNCC	3 cut(s)	108, 222, 489
PspPI	GGNCC	4 cut(s)	161, 220, 245, 314
PstI	CTGCAG	2 cut(s)	229, 285
PsuI	RGATCY	2 cut(s)	23, 106
PvuII	CAGCTG	1 cut(s)	280
SaqAI	TTAA	1 cut(s)	501
SatI	GCNGC	6 cut(s)	213, 278, 281, 284, 330, 555
Sau3AI	GATC	4 cut(s)	6, 23, 106, 423
Sau96I	GGNCC	4 cut(s)	161, 220, 245, 314
SduI	GDGCHC	1 cut(s)	37
SfcI	CTRYAG	2 cut(s)	225, 281
SinI	GGWCC	2 cut(s)	245, 314
Sse9I	AATT	3 cut(s)	186, 207, 386
SsiI	CCGC	1 cut(s)	275
SspMI	CTAG	1 cut(s)	165
StyI	CCWWGG	1 cut(s)	111
TaaI	ACNGT	1 cut(s)	234
TaqI	TCGA	1 cut(s)	122
TasI	AATT	3 cut(s)	186, 207, 386
Tru1I	TTAA	1 cut(s)	501
Tru9I	TTAA	1 cut(s)	501
TscAI	CASTG	1 cut(s)	239
TseI	GCWGC	6 cut(s)	212, 277, 280, 283, 329, 554
TspRI	CASTG	1 cut(s)	239
VpaK11BI	GGWCC	2 cut(s)	245, 314
XspI	CTAG	1 cut(s)	165

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.