Rmu_sc0011510.1_g000006

50S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011510.1
Physical Location & Seq
Forward (+)
9575 .. 10156
582 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011510.1_g000006.1.cds

Sequence Viewer

Length: 582 bp
atgaggatcattgcagttgccagatcttttcgtgctcgtcccacacgacctaaagcaactggtcatctgcaagttcgtgcgttccaacccgattttgttccgagggatcccaaggccaagtcgatacgctacaaatatccggaagtctataacccctatggccctagacccccaccctcggataaaattgttcagcttgctgaaagaattgcagctctggcccctgcagaacagtgtcaacttggtcctgcacttgtggagaagctaaagcttccgcagctgcagcccatatcaacagaaggcatggacttaggtccacagggaggggctgctggtgggtcaaaggctgaggagaagaaggttgagaaaactgcttttgatgtcaaattggagaagtttgaagcgtctgcaaaaatcaaggtgatcaaggaagtgagggcttttaccagtctcggattgaaggaggctaaagaacttgttgagaaggcaccttgtgtgcttaaacaagggcttaccaaagaggaagcaaatgacatgattgagaaactaaaggctgctggaggagttgctgttctggagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

193

Amino Acids

21.07

Weight (kDa)

9.58

Isoelectric Point (pI)

31.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 487
AccIII TCCGGA 1 cut(s) 139
AciI CCGC 1 cut(s) 275
AclWI GGATC 3 cut(s) 14, 101, 114
AdeI CACNNNGTG 1 cut(s) 494
AfiI CCNNNNNNNGG 2 cut(s) 178, 323
AgsI TTSAA 2 cut(s) 401, 460
AloI GAACNNNNNNTCC 1 cut(s) 555
AluBI AGCT 5 cut(s) 196, 215, 265, 271, 280
AluI AGCT 5 cut(s) 196, 215, 265, 271, 280
Alw21I GWGCWC 1 cut(s) 37
Alw26I GTCTC 1 cut(s) 455
AlwI GGATC 3 cut(s) 14, 101, 114
Aor13HI TCCGGA 1 cut(s) 139
AoxI GGCC 3 cut(s) 114, 160, 219
ApeKI GCWGC 6 cut(s) 212, 277, 280, 283, 329, 554
AspS9I GGNCC 4 cut(s) 161, 220, 245, 314
AsuHPI GGTGA 1 cut(s) 433
AvaII GGWCC 2 cut(s) 245, 314
BamHI GGATCC 1 cut(s) 106
BanI GGYRCC 1 cut(s) 487
Bbv12I GWGCWC 1 cut(s) 37
BbvCI CCTCAGC 1 cut(s) 348
BbvI GCAGC 6 cut(s) 224, 267, 289, 295, 316, 541
BclI TGATCA 1 cut(s) 423
BcoDI GTCTC 1 cut(s) 455
BfaI CTAG 1 cut(s) 165
BfmI CTRYAG 2 cut(s) 225, 281
BglII AGATCT 1 cut(s) 23
BisI GCNGC 6 cut(s) 213, 278, 281, 284, 330, 555
BlsI GCNGC 6 cut(s) 214, 279, 282, 285, 331, 556
Bme18I GGWCC 2 cut(s) 245, 314
BmgT120I GGNCC 4 cut(s) 161, 220, 245, 314
BmiI GGNNCC 3 cut(s) 108, 222, 489
BoxI GACNNNNGTC 1 cut(s) 312
BpmI CTGGAG 1 cut(s) 579
Bpu10I CCTNAGC 1 cut(s) 348
BsaJI CCNNGG 3 cut(s) 101, 111, 177
BsaWI WCCGGW 1 cut(s) 139
BsaXI ACNNNNNCTCC 1 cut(s) 555
Bsc4I CCNNNNNNNGG 2 cut(s) 178, 323
Bse1I ACTGG 2 cut(s) 64, 447
Bse3DI GCAATG 1 cut(s) 9
BseAI TCCGGA 1 cut(s) 139
BseDI CCNNGG 3 cut(s) 101, 111, 177
BseLI CCNNNNNNNGG 2 cut(s) 178, 323
BseMI GCAATG 1 cut(s) 9
BseMII CTCAG 1 cut(s) 339
BseNI ACTGG 2 cut(s) 64, 447
BseRI GAGGAG 2 cut(s) 365, 576
BseXI GCAGC 6 cut(s) 224, 267, 289, 295, 316, 541
BsgI GTGCAG 1 cut(s) 234
BshFI GGCC 3 cut(s) 116, 162, 221
BshNI GGYRCC 1 cut(s) 487
BsiHKAI GWGCWC 1 cut(s) 37
BsiSI CCGG 1 cut(s) 140
BslFI GGGAC 1 cut(s) 24
BslI CCNNNNNNNGG 2 cut(s) 178, 323
BsmAI GTCTC 1 cut(s) 455
BsmFI GGGAC 1 cut(s) 24
BsnI GGCC 3 cut(s) 116, 162, 221
Bsp1286I GDGCHC 1 cut(s) 37
Bsp13I TCCGGA 1 cut(s) 139
Bsp143I GATC 4 cut(s) 6, 23, 106, 423
BspACI CCGC 1 cut(s) 275
BspANI GGCC 3 cut(s) 116, 162, 221
BspCNI CTCAG 1 cut(s) 340
BspEI TCCGGA 1 cut(s) 139
BspLI GGNNCC 3 cut(s) 108, 222, 489
BspMAI CTGCAG 2 cut(s) 229, 285
BspPI GGATC 3 cut(s) 14, 101, 114
BspT107I GGYRCC 1 cut(s) 487
BsrDI GCAATG 1 cut(s) 9
BsrI ACTGG 2 cut(s) 64, 447
BssECI CCNNGG 3 cut(s) 101, 111, 177
BssMI GATC 4 cut(s) 6, 23, 106, 423
BssT1I CCWWGG 1 cut(s) 111
Bst4CI ACNGT 1 cut(s) 234
BstC8I GCNNGC 1 cut(s) 198
BstDEI CTNAG 2 cut(s) 310, 348
BstKTI GATC 4 cut(s) 9, 26, 109, 426
BstMAI GTCTC 1 cut(s) 455
BstMBI GATC 4 cut(s) 6, 23, 106, 423
BstMWI GCNNNNNNNGC 3 cut(s) 218, 277, 283
BstPAI GACNNNNGTC 1 cut(s) 312
BstSFI CTRYAG 2 cut(s) 225, 281
BstV1I GCAGC 6 cut(s) 224, 267, 289, 295, 316, 541
BstX2I RGATCY 2 cut(s) 23, 106
BstYI RGATCY 2 cut(s) 23, 106
BsuRI GGCC 3 cut(s) 116, 162, 221
BtsIMutI CAGTG 1 cut(s) 239
Cac8I GCNNGC 1 cut(s) 198
Cfr13I GGNCC 4 cut(s) 161, 220, 245, 314
CseI GACGC 1 cut(s) 393
CviAII CATG 2 cut(s) 304, 535
DdeI CTNAG 2 cut(s) 310, 348
DpnI GATC 4 cut(s) 8, 25, 108, 425
DpnII GATC 4 cut(s) 6, 23, 106, 423
DraIII CACNNNGTG 1 cut(s) 494
Eco130I CCWWGG 1 cut(s) 111
Eco47I GGWCC 2 cut(s) 245, 314
EcoT14I CCWWGG 1 cut(s) 111
ErhI CCWWGG 1 cut(s) 111
FaeI CATG 2 cut(s) 307, 538
FaiI YATR 5 cut(s) 150, 159, 290, 305, 536
FaqI GGGAC 1 cut(s) 24
FatI CATG 2 cut(s) 303, 534
FbaI TGATCA 1 cut(s) 423
Fnu4HI GCNGC 6 cut(s) 213, 278, 281, 284, 330, 555
Fsp4HI GCNGC 6 cut(s) 213, 278, 281, 284, 330, 555
FspBI CTAG 1 cut(s) 165
GluI GCNGC 6 cut(s) 213, 278, 281, 284, 330, 555
GsuI CTGGAG 1 cut(s) 579
HaeIII GGCC 3 cut(s) 116, 162, 221
HapII CCGG 1 cut(s) 140
HgaI GACGC 1 cut(s) 393
Hin1II CATG 2 cut(s) 307, 538
HincII GTYRAC 1 cut(s) 239
HindII GTYRAC 1 cut(s) 239
HindIII AAGCTT 1 cut(s) 269
HpaII CCGG 1 cut(s) 140
HphI GGTGA 1 cut(s) 433
Hpy166II GTNNAC 2 cut(s) 239, 317
Hpy188I TCNGA 3 cut(s) 102, 181, 455
Hpy188III TCNNGA 2 cut(s) 140, 575
Hpy8I GTNNAC 2 cut(s) 239, 317
HpyAV CCTTC 4 cut(s) 293, 352, 454, 478
HpyCH4III ACNGT 1 cut(s) 234
HpyCH4V TGCA 7 cut(s) 14, 70, 212, 227, 251, 283, 410
HpyF10VI GCNNNNNNNGC 3 cut(s) 218, 277, 283
HpyF3I CTNAG 2 cut(s) 310, 348
Hsp92II CATG 2 cut(s) 307, 538
Kpn2I TCCGGA 1 cut(s) 139
Ksp22I TGATCA 1 cut(s) 423
Kzo9I GATC 4 cut(s) 6, 23, 106, 423
Lsp1109I GCAGC 6 cut(s) 224, 267, 289, 295, 316, 541
MaeI CTAG 1 cut(s) 165
MalI GATC 4 cut(s) 8, 25, 108, 425
MboI GATC 4 cut(s) 6, 23, 106, 423
MboII GAAGA 1 cut(s) 367
MflI RGATCY 2 cut(s) 23, 106
MhlI GDGCHC 1 cut(s) 37
MluCI AATT 3 cut(s) 186, 207, 386
MmeI TCCRAC 1 cut(s) 109
MnlI CCTC 8 cut(s) 96, 187, 317, 343, 429, 457, 514, 554
MroI TCCGGA 1 cut(s) 139
MseI TTAA 1 cut(s) 501
MspA1I CMGCKG 1 cut(s) 280
MspI CCGG 1 cut(s) 140
MwoI GCNNNNNNNGC 3 cut(s) 218, 277, 283
NdeII GATC 4 cut(s) 6, 23, 106, 423
NlaIII CATG 2 cut(s) 307, 538
NlaIV GGNNCC 3 cut(s) 108, 222, 489
PcsI WCGNNNNNNNCGW 1 cut(s) 43
PkrI GCNGC 6 cut(s) 214, 279, 282, 285, 331, 556
PshAI GACNNNNGTC 1 cut(s) 312
PspN4I GGNNCC 3 cut(s) 108, 222, 489
PspPI GGNCC 4 cut(s) 161, 220, 245, 314
PstI CTGCAG 2 cut(s) 229, 285
PsuI RGATCY 2 cut(s) 23, 106
PvuII CAGCTG 1 cut(s) 280
SaqAI TTAA 1 cut(s) 501
SatI GCNGC 6 cut(s) 213, 278, 281, 284, 330, 555
Sau3AI GATC 4 cut(s) 6, 23, 106, 423
Sau96I GGNCC 4 cut(s) 161, 220, 245, 314
SduI GDGCHC 1 cut(s) 37
SfcI CTRYAG 2 cut(s) 225, 281
SinI GGWCC 2 cut(s) 245, 314
Sse9I AATT 3 cut(s) 186, 207, 386
SsiI CCGC 1 cut(s) 275
SspMI CTAG 1 cut(s) 165
StyI CCWWGG 1 cut(s) 111
TaaI ACNGT 1 cut(s) 234
TaqI TCGA 1 cut(s) 122
TasI AATT 3 cut(s) 186, 207, 386
Tru1I TTAA 1 cut(s) 501
Tru9I TTAA 1 cut(s) 501
TscAI CASTG 1 cut(s) 239
TseI GCWGC 6 cut(s) 212, 277, 280, 283, 329, 554
TspRI CASTG 1 cut(s) 239
VpaK11BI GGWCC 2 cut(s) 245, 314
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.