Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8169084.1

Orthogroup ID

OG0007928

Physical Location & Seq

Genomic Coordinates Reverse (-)

323 .. 601

Gene Structure 279 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8169084.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 279 bp

atggacttaggtccacagggaggggctgctggtgggtcaaaggctgaggagaagaaggttgagaaaactgcttttgatgtcaaattggagaagtttgaagcgtctgcaaaaatcaaggtgatcaaggaagtgagggcttttaccagtctcggattgaaggaggctaaagaacttgttgagaaggcaccttgtgtgcttaaacaagggcttaccaaagaggaagcaaatgacatgattgagaaactaaaggctgctggaggagttgctgttctggagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_L12

Protein Analysis

92

Amino Acids

9.77

Weight (kDa)

7.78

Isoelectric Point (pI)

21.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007928)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G03130 AT3G06040 AT3G06040 AT3G06040
fragaria_vesca	FvH4_5g05340 FvH4_5g05340
malus_domestica	MD06G1173500.v1.1 MD14G1180000.v1.1
prunus_persica	Prupe.5G173000_v2.0.a1 Prupe.5G173000_v2.0.a1 Prupe.5G173000_v2.0.a1
pyrus_communis	pycom06g15470 pycom14g14980
rosa_chinensis	RchiOBHm_Chr7g0193501
rosa_laevigata	RLG00000004266
rosa_multiflora	Rmu_co8169084.1_g000001 Rmu_sc0011510.1_g000006
rosa_roxburghii	Rroxscaffold_3G00262050
rosa_rugosa	Rorug07G0009800
rosa_samantha	Rh7AG136600 Rh7BG136900 Rh7CG140300 Rh7DG138100
rosa_wichuraiana	Rw7G011640

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	184
AdeI	CACNNNGTG	1 cut(s)	191
AfiI	CCNNNNNNNGG	1 cut(s)	20
AgsI	TTSAA	2 cut(s)	98, 157
AloI	GAACNNNNNNTCC	1 cut(s)	252
Alw26I	GTCTC	1 cut(s)	152
ApeKI	GCWGC	2 cut(s)	26, 251
AspS9I	GGNCC	1 cut(s)	11
AsuHPI	GGTGA	1 cut(s)	130
AvaII	GGWCC	1 cut(s)	11
BanI	GGYRCC	1 cut(s)	184
BbvCI	CCTCAGC	1 cut(s)	45
BbvI	GCAGC	2 cut(s)	13, 238
BclI	TGATCA	1 cut(s)	120
BcoDI	GTCTC	1 cut(s)	152
BisI	GCNGC	2 cut(s)	27, 252
BlsI	GCNGC	2 cut(s)	28, 253
Bme18I	GGWCC	1 cut(s)	11
BmgT120I	GGNCC	1 cut(s)	11
BmiI	GGNNCC	1 cut(s)	186
BoxI	GACNNNNGTC	1 cut(s)	9
BpmI	CTGGAG	1 cut(s)	276
Bpu10I	CCTNAGC	1 cut(s)	45
BsaXI	ACNNNNNCTCC	1 cut(s)	252
Bsc4I	CCNNNNNNNGG	1 cut(s)	20
Bse1I	ACTGG	1 cut(s)	144
BseLI	CCNNNNNNNGG	1 cut(s)	20
BseMII	CTCAG	1 cut(s)	36
BseNI	ACTGG	1 cut(s)	144
BseRI	GAGGAG	2 cut(s)	62, 273
BseXI	GCAGC	2 cut(s)	13, 238
BshNI	GGYRCC	1 cut(s)	184
BslI	CCNNNNNNNGG	1 cut(s)	20
BsmAI	GTCTC	1 cut(s)	152
Bsp143I	GATC	1 cut(s)	120
BspCNI	CTCAG	1 cut(s)	37
BspLI	GGNNCC	1 cut(s)	186
BspT107I	GGYRCC	1 cut(s)	184
BsrI	ACTGG	1 cut(s)	144
BssMI	GATC	1 cut(s)	120
BstDEI	CTNAG	2 cut(s)	7, 45
BstKTI	GATC	1 cut(s)	123
BstMAI	GTCTC	1 cut(s)	152
BstMBI	GATC	1 cut(s)	120
BstPAI	GACNNNNGTC	1 cut(s)	9
BstV1I	GCAGC	2 cut(s)	13, 238
Cfr13I	GGNCC	1 cut(s)	11
CseI	GACGC	1 cut(s)	90
CviAII	CATG	1 cut(s)	232
CviJI	RGCY	6 cut(s)	26, 44, 137, 164, 208, 251
CviKI_1	RGCY	6 cut(s)	26, 44, 137, 164, 208, 251
DdeI	CTNAG	2 cut(s)	7, 45
DpnI	GATC	1 cut(s)	122
DpnII	GATC	1 cut(s)	120
DraIII	CACNNNGTG	1 cut(s)	191
Eco47I	GGWCC	1 cut(s)	11
FaeI	CATG	1 cut(s)	235
FaiI	YATR	1 cut(s)	233
FatI	CATG	1 cut(s)	231
FbaI	TGATCA	1 cut(s)	120
Fnu4HI	GCNGC	2 cut(s)	27, 252
Fsp4HI	GCNGC	2 cut(s)	27, 252
GluI	GCNGC	2 cut(s)	27, 252
GsuI	CTGGAG	1 cut(s)	276
HgaI	GACGC	1 cut(s)	90
Hin1II	CATG	1 cut(s)	235
HphI	GGTGA	1 cut(s)	130
Hpy166II	GTNNAC	1 cut(s)	14
Hpy188I	TCNGA	1 cut(s)	152
Hpy188III	TCNNGA	1 cut(s)	272
Hpy8I	GTNNAC	1 cut(s)	14
HpyAV	CCTTC	3 cut(s)	49, 151, 175
HpyCH4V	TGCA	1 cut(s)	107
HpyF3I	CTNAG	2 cut(s)	7, 45
Hsp92II	CATG	1 cut(s)	235
Ksp22I	TGATCA	1 cut(s)	120
Kzo9I	GATC	1 cut(s)	120
LpnPI	CCDG	5 cut(s)	2, 15, 157, 240, 257
Lsp1109I	GCAGC	2 cut(s)	13, 238
MalI	GATC	1 cut(s)	122
MboI	GATC	1 cut(s)	120
MboII	GAAGA	1 cut(s)	64
MluCI	AATT	1 cut(s)	83
MnlI	CCTC	6 cut(s)	14, 40, 126, 154, 211, 251
MseI	TTAA	1 cut(s)	198
NdeII	GATC	1 cut(s)	120
NlaIII	CATG	1 cut(s)	235
NlaIV	GGNNCC	1 cut(s)	186
PkrI	GCNGC	2 cut(s)	28, 253
PshAI	GACNNNNGTC	1 cut(s)	9
PspN4I	GGNNCC	1 cut(s)	186
PspPI	GGNCC	1 cut(s)	11
SaqAI	TTAA	1 cut(s)	198
SatI	GCNGC	2 cut(s)	27, 252
Sau3AI	GATC	1 cut(s)	120
Sau96I	GGNCC	1 cut(s)	11
SetI	ASST	4 cut(s)	13, 60, 120, 190
SinI	GGWCC	1 cut(s)	11
Sse9I	AATT	1 cut(s)	83
TasI	AATT	1 cut(s)	83
Tru1I	TTAA	1 cut(s)	198
Tru9I	TTAA	1 cut(s)	198
TseI	GCWGC	2 cut(s)	26, 251
VpaK11BI	GGWCC	1 cut(s)	11

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.