pycom07g00940

Nuclear transcription factor Y subunit

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
803071 .. 803527
457 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g00940.2

Sequence Viewer

Length: 252 bp
ATGATGCCAGCCAAATCTAAAGATGAAGATCCGCATATAAAACATGGTGCTCAGACTGTGTTGCAACCTATCTACTCCCAACCTTGGTGGCGTGGAGGGGGGAATGGTTCAGCATCATCTTTGGTGGATCACAGTAATAGTATGGTCATGAATGGAGCAATGCAGGCACAACCTAACGCTAGGCTGGACGGTGGTGGTGCCAACTTCCACAAAGAATTGCGGACTACAGTAGGATTACAGCCTGGGGAATAA

Protein Analysis

84

Amino Acids

8.88

Weight (kDa)

6.9

Isoelectric Point (pI)

39.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 197
AciI CCGC 2 cut(s) 32, 220
AclWI GGATC 2 cut(s) 23, 135
AfiI CCNNNNNNNGG 1 cut(s) 84
AjnI CCWGG 1 cut(s) 241
Alw21I GWGCWC 1 cut(s) 52
AlwI GGATC 2 cut(s) 23, 135
BanI GGYRCC 1 cut(s) 197
Bbv12I GWGCWC 1 cut(s) 52
BciT130I CCWGG 1 cut(s) 243
BfaI CTAG 1 cut(s) 180
BfmI CTRYAG 1 cut(s) 225
Bme1390I CCNGG 1 cut(s) 243
BmiI GGNNCC 1 cut(s) 199
BmrFI CCNGG 1 cut(s) 243
BmsI GCATC 1 cut(s) 122
BsaBI GATNNNNATC 1 cut(s) 27
BsaJI CCNNGG 2 cut(s) 83, 242
Bsc4I CCNNNNNNNGG 1 cut(s) 84
Bse3DI GCAATG 1 cut(s) 165
Bse8I GATNNNNATC 1 cut(s) 27
BseBI CCWGG 1 cut(s) 243
BseDI CCNNGG 2 cut(s) 83, 242
BseJI GATNNNNATC 1 cut(s) 27
BseLI CCNNNNNNNGG 1 cut(s) 84
BseMI GCAATG 1 cut(s) 165
BseMII CTCAG 1 cut(s) 65
BshNI GGYRCC 1 cut(s) 197
BsiHKAI GWGCWC 1 cut(s) 52
BslI CCNNNNNNNGG 1 cut(s) 84
Bsp1286I GDGCHC 1 cut(s) 52
Bsp143I GATC 2 cut(s) 28, 127
BspACI CCGC 2 cut(s) 32, 220
BspCNI CTCAG 1 cut(s) 64
BspHI TCATGA 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 199
BspPI GGATC 2 cut(s) 23, 135
BspT107I GGYRCC 1 cut(s) 197
BsrDI GCAATG 1 cut(s) 165
BssECI CCNNGG 2 cut(s) 83, 242
BssMI GATC 2 cut(s) 28, 127
BssT1I CCWWGG 1 cut(s) 83
Bst2UI CCWGG 1 cut(s) 243
Bst4CI ACNGT 4 cut(s) 58, 134, 191, 229
BstC8I GCNNGC 2 cut(s) 9, 165
BstDEI CTNAG 1 cut(s) 51
BstKTI GATC 2 cut(s) 31, 130
BstMBI GATC 2 cut(s) 28, 127
BstMWI GCNNNNNNNGC 1 cut(s) 164
BstNI CCWGG 1 cut(s) 243
BstSCI CCNGG 1 cut(s) 241
BstSFI CTRYAG 1 cut(s) 225
BstX2I RGATCY 1 cut(s) 28
BstYI RGATCY 1 cut(s) 28
Cac8I GCNNGC 2 cut(s) 9, 165
CciI TCATGA 1 cut(s) 147
CspCI CAANNNNNGTGG 2 cut(s) 68, 103
CviAII CATG 2 cut(s) 44, 148
CviJI RGCY 3 cut(s) 11, 184, 241
CviKI_1 RGCY 3 cut(s) 11, 184, 241
DdeI CTNAG 1 cut(s) 51
DpnI GATC 2 cut(s) 30, 129
DpnII GATC 2 cut(s) 28, 127
Eco130I CCWWGG 1 cut(s) 83
EcoRII CCWGG 1 cut(s) 241
EcoT14I CCWWGG 1 cut(s) 83
ErhI CCWWGG 1 cut(s) 83
FaeI CATG 2 cut(s) 47, 151
FaiI YATR 5 cut(s) 36, 38, 45, 143, 149
FatI CATG 2 cut(s) 43, 147
FspBI CTAG 1 cut(s) 180
Hin1II CATG 2 cut(s) 47, 151
Hpy188I TCNGA 1 cut(s) 54
Hpy188III TCNNGA 1 cut(s) 148
HpyCH4III ACNGT 4 cut(s) 58, 134, 191, 229
HpyCH4V TGCA 2 cut(s) 64, 163
HpyF10VI GCNNNNNNNGC 1 cut(s) 164
HpyF3I CTNAG 1 cut(s) 51
Hsp92II CATG 2 cut(s) 47, 151
Kzo9I GATC 2 cut(s) 28, 127
LmnI GCTCC 1 cut(s) 155
LpnPI CCDG 4 cut(s) 21, 149, 170, 228
LweI GCATC 1 cut(s) 122
MaeI CTAG 1 cut(s) 180
MalI GATC 2 cut(s) 30, 129
MboI GATC 2 cut(s) 28, 127
MboII GAAGA 1 cut(s) 38
MflI RGATCY 1 cut(s) 28
MhlI GDGCHC 1 cut(s) 52
MluCI AATT 1 cut(s) 215
MnlI CCTC 1 cut(s) 89
MspR9I CCNGG 1 cut(s) 243
MvaI CCWGG 1 cut(s) 243
MwoI GCNNNNNNNGC 1 cut(s) 164
NdeII GATC 2 cut(s) 28, 127
NlaIII CATG 2 cut(s) 47, 151
NlaIV GGNNCC 1 cut(s) 199
PagI TCATGA 1 cut(s) 147
Psp6I CCWGG 1 cut(s) 241
PspGI CCWGG 1 cut(s) 241
PspN4I GGNNCC 1 cut(s) 199
PsuI RGATCY 1 cut(s) 28
Sau3AI GATC 2 cut(s) 28, 127
ScrFI CCNGG 1 cut(s) 243
SduI GDGCHC 1 cut(s) 52
SetI ASST 3 cut(s) 70, 85, 175
SfaNI GCATC 1 cut(s) 122
SfcI CTRYAG 1 cut(s) 225
SgeI CNNG 8 cut(s) 20, 56, 96, 104, 160, 176, 192, 197
Sse9I AATT 1 cut(s) 215
SsiI CCGC 2 cut(s) 32, 220
SspMI CTAG 1 cut(s) 180
StyD4I CCNGG 1 cut(s) 241
StyI CCWWGG 1 cut(s) 83
TaaI ACNGT 4 cut(s) 58, 134, 191, 229
TasI AATT 1 cut(s) 215
TspDTI ATGAA 2 cut(s) 39, 164
XspI CTAG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.