pycom07g01420

zinc-finger of the FCS-type, C2-C2

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
1057192 .. 1057377
186 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g01420.1

Sequence Viewer

Length: 186 bp
ATGGCGGAAAACGGCTCTCTTCTCTCCCCCAGAGAAAAACACACAAAACTCACTTCCTCTTTCTTCGCAAATCTGAGATTGTTCACCAGCTTCACCTCAAAAGTCGTCTCTGAATCCGAAGCCATAATGAGCCCAACCTCCATCCTCGAAATGAAACCGTTTGTGGTCCGAATCGAACACCCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.86

Weight (kDa)

8.23

Isoelectric Point (pI)

52.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AluBI AGCT 1 cut(s) 90
AluI AGCT 1 cut(s) 90
Alw26I GTCTC 1 cut(s) 112
AspS9I GGNCC 1 cut(s) 166
AsuHPI GGTGA 2 cut(s) 76, 85
AvaII GGWCC 1 cut(s) 166
BanII GRGCYC 1 cut(s) 134
BccI CCATC 1 cut(s) 149
BceAI ACGGC 1 cut(s) 28
BcoDI GTCTC 1 cut(s) 112
BfaI CTAG 1 cut(s) 184
Bme18I GGWCC 1 cut(s) 166
BmgT120I GGNCC 1 cut(s) 166
BseGI GGATG 1 cut(s) 141
BseMII CTCAG 1 cut(s) 65
BsmAI GTCTC 1 cut(s) 112
BsmBI CGTCTC 1 cut(s) 112
Bsp1286I GDGCHC 1 cut(s) 134
BspACI CCGC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 66
Bst4CI ACNGT 1 cut(s) 159
Bst6I CTCTTC 1 cut(s) 24
BstDEI CTNAG 1 cut(s) 74
BstF5I GGATG 1 cut(s) 141
BstMAI GTCTC 1 cut(s) 112
BtsCI GGATG 1 cut(s) 141
Cfr13I GGNCC 1 cut(s) 166
CviJI RGCY 4 cut(s) 15, 90, 122, 132
CviKI_1 RGCY 4 cut(s) 15, 90, 122, 132
DdeI CTNAG 1 cut(s) 74
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
EciI GGCGGA 1 cut(s) 20
Eco24I GRGCYC 1 cut(s) 134
Eco47I GGWCC 1 cut(s) 166
EcoT38I GRGCYC 1 cut(s) 134
Esp3I CGTCTC 1 cut(s) 112
FaiI YATR 1 cut(s) 125
FokI GGATG 1 cut(s) 128
FriOI GRGCYC 1 cut(s) 134
FspBI CTAG 1 cut(s) 184
HinfI GANTC 2 cut(s) 113, 171
HphI GGTGA 2 cut(s) 76, 85
Hpy166II GTNNAC 1 cut(s) 84
Hpy188I TCNGA 4 cut(s) 75, 112, 118, 170
Hpy8I GTNNAC 1 cut(s) 84
HpyCH4III ACNGT 1 cut(s) 159
HpyF3I CTNAG 1 cut(s) 74
LpnPI CCDG 2 cut(s) 43, 100
MaeI CTAG 1 cut(s) 184
MboII GAAGA 2 cut(s) 11, 55
MhlI GDGCHC 1 cut(s) 134
MnlI CCTC 4 cut(s) 67, 106, 148, 155
PfeI GAWTC 2 cut(s) 113, 171
PspPI GGNCC 1 cut(s) 166
Sau96I GGNCC 1 cut(s) 166
SduI GDGCHC 1 cut(s) 134
SetI ASST 3 cut(s) 92, 98, 140
SgeI CNNG 3 cut(s) 42, 99, 158
SinI GGWCC 1 cut(s) 166
SsiI CCGC 1 cut(s) 5
SspMI CTAG 1 cut(s) 184
TaaI ACNGT 1 cut(s) 159
TaqI TCGA 2 cut(s) 147, 174
TfiI GAWTC 2 cut(s) 113, 171
TspDTI ATGAA 1 cut(s) 167
VpaK11BI GGWCC 1 cut(s) 166
XspI CTAG 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.