pycom07g17180

Assembly, mitochondrial proton-transport ATP synth complex

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
19716945 .. 19717148
204 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g17180.1

Sequence Viewer

Length: 204 bp
ATGATGTCATGGCTTGCAACATTCATCCCGAGGACTATTAAGTTTTCTGATATCCGGCCAGCAGAAACTAATCGGCCTTTTGTGACTTTTAAGGCCAATGGAAACTTTTACTTTGTCGACGCTGATCATTGTCATAACAAGGCTTTGTTAGCAAGACTGACCCCGCAGAAAGCAACTCATGAGTCGGCTTTTAAGAATTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.73

Weight (kDa)

9.74

Isoelectric Point (pI)

35.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012541)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 117
AciI CCGC 1 cut(s) 164
AcoI YGGCCR 1 cut(s) 56
AcsI RAATTY 1 cut(s) 196
Ama87I CYCGRG 1 cut(s) 28
AoxI GGCC 3 cut(s) 56, 74, 93
ApoI RAATTY 1 cut(s) 196
AvaI CYCGRG 1 cut(s) 28
BclI TGATCA 1 cut(s) 124
BmeT110I CYCGRG 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 29
BseDI CCNNGG 1 cut(s) 29
BseGI GGATG 1 cut(s) 24
BshFI GGCC 3 cut(s) 58, 76, 95
BsiHKCI CYCGRG 1 cut(s) 28
BsiSI CCGG 1 cut(s) 55
BsnI GGCC 3 cut(s) 58, 76, 95
BsoBI CYCGRG 1 cut(s) 28
Bsp143I GATC 1 cut(s) 124
BspACI CCGC 1 cut(s) 164
BspANI GGCC 3 cut(s) 58, 76, 95
BspHI TCATGA 1 cut(s) 178
BssECI CCNNGG 1 cut(s) 29
BssMI GATC 1 cut(s) 124
BstC8I GCNNGC 2 cut(s) 15, 60
BstF5I GGATG 1 cut(s) 24
BstKTI GATC 1 cut(s) 127
BstMBI GATC 1 cut(s) 124
BstMWI GCNNNNNNNGC 1 cut(s) 149
BsuRI GGCC 3 cut(s) 58, 76, 95
BtsCI GGATG 1 cut(s) 24
Cac8I GCNNGC 2 cut(s) 15, 60
CciI TCATGA 1 cut(s) 178
CseI GACGC 1 cut(s) 128
CviAII CATG 2 cut(s) 9, 179
CviJI RGCY 6 cut(s) 13, 58, 76, 95, 143, 188
CviKI_1 RGCY 6 cut(s) 13, 58, 76, 95, 143, 188
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
EaeI YGGCCR 1 cut(s) 56
Eco32I GATATC 1 cut(s) 52
Eco88I CYCGRG 1 cut(s) 28
EcoRV GATATC 1 cut(s) 52
FaeI CATG 2 cut(s) 12, 182
FaiI YATR 4 cut(s) 10, 135, 180, 202
FatI CATG 2 cut(s) 8, 178
FauI CCCGC 1 cut(s) 171
FbaI TGATCA 1 cut(s) 124
FblI GTMKAC 1 cut(s) 117
FokI GGATG 1 cut(s) 11
HaeIII GGCC 3 cut(s) 58, 76, 95
HapII CCGG 1 cut(s) 55
HgaI GACGC 1 cut(s) 128
Hin1II CATG 2 cut(s) 12, 182
HincII GTYRAC 1 cut(s) 118
HindII GTYRAC 1 cut(s) 118
HinfI GANTC 1 cut(s) 182
HpaII CCGG 1 cut(s) 55
Hpy166II GTNNAC 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 49
Hpy188III TCNNGA 2 cut(s) 28, 179
Hpy8I GTNNAC 1 cut(s) 118
Hpy99I CGWCG 1 cut(s) 122
HpyCH4V TGCA 1 cut(s) 17
HpyF10VI GCNNNNNNNGC 1 cut(s) 149
Hsp92II CATG 2 cut(s) 12, 182
Ksp22I TGATCA 1 cut(s) 124
Kzo9I GATC 1 cut(s) 124
LpnPI CCDG 2 cut(s) 68, 72
MaeIII GTNAC 1 cut(s) 82
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MluCI AATT 1 cut(s) 196
MlyI GAGTC 1 cut(s) 191
MnlI CCTC 1 cut(s) 24
MseI TTAA 3 cut(s) 39, 90, 192
MspI CCGG 1 cut(s) 55
MwoI GCNNNNNNNGC 1 cut(s) 149
NdeII GATC 1 cut(s) 124
NlaIII CATG 2 cut(s) 12, 182
NmuCI GTSAC 1 cut(s) 82
PagI TCATGA 1 cut(s) 178
PleI GAGTC 1 cut(s) 190
PpsI GAGTC 1 cut(s) 190
SalI GTCGAC 1 cut(s) 116
SaqAI TTAA 3 cut(s) 39, 90, 192
Sau3AI GATC 1 cut(s) 124
SchI GAGTC 1 cut(s) 191
Sse9I AATT 1 cut(s) 196
SsiI CCGC 1 cut(s) 164
TaqI TCGA 1 cut(s) 117
TasI AATT 1 cut(s) 196
Tru1I TTAA 3 cut(s) 39, 90, 192
Tru9I TTAA 3 cut(s) 39, 90, 192
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 13
XapI RAATTY 1 cut(s) 196
XmiI GTMKAC 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.