Rmu_sc0001607.1_g000014

Assembly, mitochondrial proton-transport ATP synth complex

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001607.1
OG0012541
Physical Location & Seq
Forward (+)
68296 .. 69922
1627 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001607.1_g000014.1.cds

Sequence Viewer

Length: 735 bp
atggcgaggactgctctccttcacttgatccgatcacactctaaaaacctcgcgacatcaaatttccttgcaggttatcaaccttataagtctggaacatgggcacgtggtcgtggcctgaacaacaaacctagtttcaactctggtgttgggatcaatgctttccagaagagatgggtgtctcaagctgcaacaagagaagatgatggcaaaatcagcattggaccacgtagaggtgtcgaaactgggaaagatgaaaaagattctgggattgtttactatggtccgatctcatctactatcaagaaagtgaaacttctctcgctttcaacctgctgcctttctgtatctttaggccctgtgataacctttatgacatcacctgatatgaatgttatcttgaagggtgcggtggcatcttcagtgatattcttaagtgcttctaccacagctgcccttcactggtttgtgaccccatacattcacaagctcaagtggaagcctggttcagacagttttgaggtcgaaatgttgtcatggctagcaacttacataccaaggacaattaagttcgccgatatccggccaccagaaacccaaaggccgtttgtgactttcaaggccaatggacagttttacttcgttgatgctgatcattgtcagaataaggctttgttagcaaagctgaccccgcagaaaggaccaactcgtgagtctgcttttaagaacttgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TMEM70

Protein Analysis

244

Amino Acids

26.95

Weight (kDa)

9.92

Isoelectric Point (pI)

23.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012541)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G35790
fragaria_vesca FvH4_7g20020
malus_domestica MD01G1111700.v1.1 MD07G1177900.v1.1
prunus_persica Prupe.2G217200_v2.0.a1 Prupe.2G217200_v2.0.a1
pyrus_communis pycom01g13890 pycom07g17170 pycom07g17180
rosa_chinensis RchiOBHm_Chr1g0363981
rosa_laevigata RLG00000027531
rosa_multiflora Rmu_sc0001607.1_g000014 Rmu_ssc0000167.1_g000025
rosa_roxburghii Rroxscaffold_4G00292790
rosa_rugosa Rorug01G0311700 Rorug01G0311800
rosa_samantha Rh1BG282700 Rh1DG314100
rosa_wichuraiana Rw1G028330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 87
Acc36I ACCTGC 2 cut(s) 62, 341
AccII CGCG 1 cut(s) 53
AciI CCGC 2 cut(s) 410, 692
AclWI GGATC 2 cut(s) 22, 161
AcoI YGGCCR 1 cut(s) 584
AcsI RAATTY 1 cut(s) 61
AcuI CTGAAG 1 cut(s) 405
AcvI CACGTG 1 cut(s) 107
AfiI CCNNNNNNNGG 4 cut(s) 233, 462, 582, 698
AflII CTTAAG 1 cut(s) 433
AgsI TTSAA 4 cut(s) 139, 330, 403, 619
AjnI CCWGG 1 cut(s) 502
AloI GAACNNNNNNTCC 2 cut(s) 490, 522
AluBI AGCT 4 cut(s) 188, 452, 490, 685
AluI AGCT 4 cut(s) 188, 452, 490, 685
Alw26I GTCTC 1 cut(s) 186
AlwI GGATC 2 cut(s) 22, 161
AoxI GGCC 5 cut(s) 115, 355, 584, 602, 621
ApeKI GCWGC 3 cut(s) 188, 336, 452
ApoI RAATTY 1 cut(s) 61
AspS9I GGNCC 4 cut(s) 224, 284, 356, 701
AsuHPI GGTGA 1 cut(s) 372
AsuNHI GCTAGC 1 cut(s) 541
AvaII GGWCC 3 cut(s) 224, 284, 701
BaeGI GKGCMC 1 cut(s) 106
BauI CACGAG 1 cut(s) 708
BbrPI CACGTG 1 cut(s) 107
BbvI GCAGC 3 cut(s) 175, 323, 439
BccI CCATC 2 cut(s) 168, 200
BceAI ACGGC 1 cut(s) 589
BciT130I CCWGG 1 cut(s) 504
BclI TGATCA 1 cut(s) 652
BcoDI GTCTC 1 cut(s) 186
BfaI CTAG 2 cut(s) 132, 542
BfrI CTTAAG 1 cut(s) 433
BfuAI ACCTGC 2 cut(s) 62, 341
BisI GCNGC 3 cut(s) 189, 337, 453
BlsI GCNGC 3 cut(s) 190, 338, 454
Bme1390I CCNGG 1 cut(s) 504
Bme18I GGWCC 3 cut(s) 224, 284, 701
BmgT120I GGNCC 4 cut(s) 224, 284, 356, 701
BmrFI CCNGG 1 cut(s) 504
BmrI ACTGGG 1 cut(s) 255
BmsI GCATC 2 cut(s) 425, 637
BmtI GCTAGC 1 cut(s) 545
BmuI ACTGGG 1 cut(s) 255
BplI GAGNNNNNCTC 1 cut(s) 30
BpuEI CTTGAG 2 cut(s) 168, 476
BsaAI YACGTR 2 cut(s) 107, 230
BsaBI GATNNNNATC 1 cut(s) 651
BsaJI CCNNGG 1 cut(s) 557
Bsc4I CCNNNNNNNGG 4 cut(s) 233, 462, 582, 698
Bse1I ACTGG 2 cut(s) 250, 467
Bse8I GATNNNNATC 1 cut(s) 651
BseBI CCWGG 1 cut(s) 504
BseDI CCNNGG 1 cut(s) 557
BseJI GATNNNNATC 1 cut(s) 651
BseLI CCNNNNNNNGG 4 cut(s) 233, 462, 582, 698
BseNI ACTGG 2 cut(s) 250, 467
BseSI GKGCMC 1 cut(s) 106
BseXI GCAGC 3 cut(s) 175, 323, 439
Bsh1236I CGCG 1 cut(s) 53
BshFI GGCC 5 cut(s) 117, 357, 586, 604, 623
BsiSI CCGG 1 cut(s) 583
BslI CCNNNNNNNGG 4 cut(s) 233, 462, 582, 698
BsmAI GTCTC 1 cut(s) 186
BsnI GGCC 5 cut(s) 117, 357, 586, 604, 623
Bsp1286I GDGCHC 1 cut(s) 106
Bsp143I GATC 5 cut(s) 27, 32, 153, 288, 652
Bsp68I TCGCGA 1 cut(s) 53
BspACI CCGC 2 cut(s) 410, 692
BspANI GGCC 5 cut(s) 117, 357, 586, 604, 623
BspFNI CGCG 1 cut(s) 53
BspMI ACCTGC 2 cut(s) 62, 341
BspOI GCTAGC 1 cut(s) 545
BspPI GGATC 2 cut(s) 22, 161
BspTI CTTAAG 1 cut(s) 433
BsrI ACTGG 2 cut(s) 250, 467
BssECI CCNNGG 1 cut(s) 557
BssMI GATC 5 cut(s) 27, 32, 153, 288, 652
BssSI CACGAG 1 cut(s) 708
BssT1I CCWWGG 1 cut(s) 557
Bst2BI CACGAG 1 cut(s) 708
Bst2UI CCWGG 1 cut(s) 504
Bst4CI ACNGT 2 cut(s) 515, 633
Bst6I CTCTTC 1 cut(s) 164
BstAFI CTTAAG 1 cut(s) 433
BstBAI YACGTR 2 cut(s) 107, 230
BstC8I GCNNGC 1 cut(s) 543
BstFNI CGCG 1 cut(s) 53
BstKTI GATC 5 cut(s) 30, 35, 156, 291, 655
BstMAI GTCTC 1 cut(s) 186
BstMBI GATC 5 cut(s) 27, 32, 153, 288, 652
BstMWI GCNNNNNNNGC 4 cut(s) 11, 216, 677, 691
BstNI CCWGG 1 cut(s) 504
BstSCI CCNGG 1 cut(s) 502
BstSLI GKGCMC 1 cut(s) 106
BstUI CGCG 1 cut(s) 53
BstV1I GCAGC 3 cut(s) 175, 323, 439
BsuRI GGCC 5 cut(s) 117, 357, 586, 604, 623
BtsIMutI CAGTG 2 cut(s) 429, 460
BtuMI TCGCGA 1 cut(s) 53
BveI ACCTGC 2 cut(s) 62, 341
Cac8I GCNNGC 1 cut(s) 543
Cfr13I GGNCC 4 cut(s) 224, 284, 356, 701
CviAII CATG 2 cut(s) 99, 537
DpnI GATC 5 cut(s) 29, 34, 155, 290, 654
DpnII GATC 5 cut(s) 27, 32, 153, 288, 652
EaeI YGGCCR 1 cut(s) 584
Eam1104I CTCTTC 1 cut(s) 164
EarI CTCTTC 1 cut(s) 164
Eco130I CCWWGG 1 cut(s) 557
Eco32I GATATC 1 cut(s) 580
Eco47I GGWCC 3 cut(s) 224, 284, 701
Eco57I CTGAAG 1 cut(s) 405
Eco72I CACGTG 1 cut(s) 107
EcoO109I RGGNCCY 1 cut(s) 356
EcoRII CCWGG 1 cut(s) 502
EcoRV GATATC 1 cut(s) 580
EcoT14I CCWWGG 1 cut(s) 557
ErhI CCWWGG 1 cut(s) 557
FaeI CATG 2 cut(s) 102, 540
FaiI YATR 8 cut(s) 87, 100, 282, 374, 389, 478, 538, 554
FalI AAGNNNNNCTT 2 cut(s) 300, 332
FatI CATG 2 cut(s) 98, 536
FauI CCCGC 1 cut(s) 699
FbaI TGATCA 1 cut(s) 652
Fnu4HI GCNGC 3 cut(s) 189, 337, 453
Fsp4HI GCNGC 3 cut(s) 189, 337, 453
FspBI CTAG 2 cut(s) 132, 542
GluI GCNGC 3 cut(s) 189, 337, 453
HaeIII GGCC 5 cut(s) 117, 357, 586, 604, 623
HapII CCGG 1 cut(s) 583
Hin1II CATG 2 cut(s) 102, 540
HinfI GANTC 2 cut(s) 263, 713
HpaII CCGG 1 cut(s) 583
HphI GGTGA 1 cut(s) 372
Hpy166II GTNNAC 1 cut(s) 277
Hpy188I TCNGA 4 cut(s) 32, 288, 511, 663
Hpy188III TCNNGA 6 cut(s) 52, 93, 166, 304, 400, 710
Hpy8I GTNNAC 1 cut(s) 277
HpyAV CCTTC 3 cut(s) 29, 397, 467
HpyCH4III ACNGT 2 cut(s) 515, 633
HpyCH4IV ACGT 2 cut(s) 106, 229
HpyCH4V TGCA 2 cut(s) 71, 191
HpyF10VI GCNNNNNNNGC 4 cut(s) 11, 216, 677, 691
HpySE526I ACGT 2 cut(s) 106, 229
Hsp92II CATG 2 cut(s) 102, 540
Ksp22I TGATCA 1 cut(s) 652
Kzo9I GATC 5 cut(s) 27, 32, 153, 288, 652
Lsp1109I GCAGC 3 cut(s) 175, 323, 439
LweI GCATC 2 cut(s) 425, 637
MaeI CTAG 2 cut(s) 132, 542
MaeII ACGT 2 cut(s) 106, 229
MaeIII GTNAC 2 cut(s) 469, 610
MalI GATC 5 cut(s) 29, 34, 155, 290, 654
MboI GATC 5 cut(s) 27, 32, 153, 288, 652
MboII GAAGA 3 cut(s) 181, 212, 411
MhlI GDGCHC 1 cut(s) 106
MluCI AATT 2 cut(s) 61, 564
MlyI GAGTC 1 cut(s) 722
MnlI CCTC 3 cut(s) 59, 227, 514
MseI TTAA 3 cut(s) 434, 567, 723
MspA1I CMGCKG 1 cut(s) 452
MspCI CTTAAG 1 cut(s) 433
MspI CCGG 1 cut(s) 583
MspR9I CCNGG 1 cut(s) 504
MvaI CCWGG 1 cut(s) 504
MvnI CGCG 1 cut(s) 53
MwoI GCNNNNNNNGC 4 cut(s) 11, 216, 677, 691
NdeII GATC 5 cut(s) 27, 32, 153, 288, 652
NheI GCTAGC 1 cut(s) 541
NlaIII CATG 2 cut(s) 102, 540
NmuCI GTSAC 2 cut(s) 469, 610
NruI TCGCGA 1 cut(s) 53
PfeI GAWTC 1 cut(s) 263
PkrI GCNGC 3 cut(s) 190, 338, 454
PleI GAGTC 1 cut(s) 721
PmaCI CACGTG 1 cut(s) 107
PmlI CACGTG 1 cut(s) 107
PpsI GAGTC 1 cut(s) 721
Ppu21I YACGTR 2 cut(s) 107, 230
PsiI TTATAA 1 cut(s) 87
Psp6I CCWGG 1 cut(s) 502
PspCI CACGTG 1 cut(s) 107
PspGI CCWGG 1 cut(s) 502
PspPI GGNCC 4 cut(s) 224, 284, 356, 701
PvuII CAGCTG 1 cut(s) 452
RruI TCGCGA 1 cut(s) 53
SaqAI TTAA 3 cut(s) 434, 567, 723
SatI GCNGC 3 cut(s) 189, 337, 453
Sau3AI GATC 5 cut(s) 27, 32, 153, 288, 652
Sau96I GGNCC 4 cut(s) 224, 284, 356, 701
SchI GAGTC 1 cut(s) 722
ScrFI CCNGG 1 cut(s) 504
SduI GDGCHC 1 cut(s) 106
SfaNI GCATC 2 cut(s) 425, 637
SinI GGWCC 3 cut(s) 224, 284, 701
SmlI CTYRAG 3 cut(s) 183, 433, 491
SmoI CTYRAG 3 cut(s) 183, 433, 491
Sse9I AATT 2 cut(s) 61, 564
SsiI CCGC 2 cut(s) 410, 692
SspMI CTAG 2 cut(s) 132, 542
StyD4I CCNGG 1 cut(s) 502
StyI CCWWGG 1 cut(s) 557
TaaI ACNGT 2 cut(s) 515, 633
TaiI ACGT 2 cut(s) 109, 232
TaqI TCGA 2 cut(s) 240, 525
TasI AATT 2 cut(s) 61, 564
TfiI GAWTC 1 cut(s) 263
Tru1I TTAA 3 cut(s) 434, 567, 723
Tru9I TTAA 3 cut(s) 434, 567, 723
TscAI CASTG 2 cut(s) 429, 467
TseFI GTSAC 2 cut(s) 469, 610
TseI GCWGC 3 cut(s) 188, 336, 452
Tsp45I GTSAC 2 cut(s) 469, 610
TspDTI ATGAA 2 cut(s) 270, 404
TspRI CASTG 2 cut(s) 429, 467
Vha464I CTTAAG 1 cut(s) 433
VpaK11BI GGWCC 3 cut(s) 224, 284, 701
XapI RAATTY 1 cut(s) 61
XspI CTAG 2 cut(s) 132, 542
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.