Rmu_ssc0000167.1_g000025

Assembly, mitochondrial proton-transport ATP synth complex

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000167.1
OG0012541
Physical Location & Seq
Reverse (-)
133417 .. 137274
3858 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000167.1_g000025.1.cds

Sequence Viewer

Length: 1284 bp
atgaatgtgagtagaaaaactggacgagaacaagataagaatgagaaggaagcgttgagccatttgcctagcgctgcgagagaggaaaaacatcaccaaattgttcccagtccggcggcggccaggatagcatcggctttgcccagttgtcgctgtgctggctgccggacgggggcttcgaagccctgggctgaggtcgggagagaagctgttttagcttgtggcttggcagacaggtttggtgtaggttcgggcggcctttctgggcgtttatgtggcttggggggctcgcagcaatgttggcttgtgaaggagctcgacagtgcggtttgtggagaggcagactcgtgggtggcgctgcacctacgtggtctcgtgggtggcggctgcaggcacggtggcgtggtagtctgggcttgggtcaaccctcttgctgggcttaagttgggctattctctttggggctgccctattgggctctctaatttaggctctggggtttttagccctaagcccatctatataatcagagttgaagaggcaaaagagatggcgaggactgctctccttcacttgctccgatcacactctaaaaaccttgcgacatcaaatttccttgcaggttatcaaccttgtaagtctggagcatgggcacgtggtcgtggcctgaacaacaaacctagtttcaactctggtgtcgggatcaatgctttccagaagagatgggtgtctcaagctgcaacaagagaagatgatggaaaaatcagcattggaccacgtagaggtgttgaaactgggaaagatgaaaaagattctgggattgtatactatggtccgatctcatctactatcaagaaagtgaaacttctctcgctttcaacatgctgcctttctgtatctttaggccctgtgataacctttatgacatcacctgatatgaatgttatcttaaagggtgcggtggcatcttcagtgatattcttaagtgcttctaccacagctgcccttcactggtttgtgaccccatacattcacaagctcaagtggaagcctggttcagacagttttgaggtcgaaatgttgtcatggctagcaacttacataccaaggacaattaagttcgccgatatccggccaccagaaacccaaaggccttttgtgactttcaaggccaatggacagttttacttcgttgatgctgatcattgtcagaataaggctttgttagcaaagctgacccctcagaaagcaccaactcctgagtctgcttttaagaacttgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TMEM70

Protein Analysis

427

Amino Acids

45.99

Weight (kDa)

9.51

Isoelectric Point (pI)

29.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012541)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G35790
fragaria_vesca FvH4_7g20020
malus_domestica MD01G1111700.v1.1 MD07G1177900.v1.1
prunus_persica Prupe.2G217200_v2.0.a1 Prupe.2G217200_v2.0.a1
pyrus_communis pycom01g13890 pycom07g17170 pycom07g17180
rosa_chinensis RchiOBHm_Chr1g0363981
rosa_laevigata RLG00000027531
rosa_multiflora Rmu_sc0001607.1_g000014 Rmu_ssc0000167.1_g000025
rosa_roxburghii Rroxscaffold_4G00292790
rosa_rugosa Rorug01G0311700 Rorug01G0311800
rosa_samantha Rh1BG282700 Rh1DG314100
rosa_wichuraiana Rw1G028330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 611
AccI GTMKAC 1 cut(s) 825
AciI CCGC 6 cut(s) 116, 119, 255, 326, 384, 959
AclWI GGATC 1 cut(s) 710
AcoI YGGCCR 2 cut(s) 120, 1133
AcsI RAATTY 1 cut(s) 610
AcuI CTGAAG 1 cut(s) 954
AcvI CACGTG 1 cut(s) 656
AfeI AGCGCT 1 cut(s) 73
AfiI CCNNNNNNNGG 5 cut(s) 172, 434, 782, 1011, 1131
AflII CTTAAG 2 cut(s) 440, 982
AgsI TTSAA 5 cut(s) 536, 688, 791, 879, 1168
AjnI CCWGG 3 cut(s) 122, 185, 1051
AleI CACNNNNGTG 1 cut(s) 366
AloI GAACNNNNNNTCC 2 cut(s) 1039, 1071
AluBI AGCT 7 cut(s) 209, 218, 316, 737, 1001, 1039, 1234
AluI AGCT 7 cut(s) 209, 218, 316, 737, 1001, 1039, 1234
Alw21I GWGCWC 1 cut(s) 318
Alw26I GTCTC 2 cut(s) 377, 735
AlwI GGATC 1 cut(s) 710
Aor51HI AGCGCT 1 cut(s) 73
AoxI GGCC 7 cut(s) 120, 256, 664, 904, 1133, 1151, 1170
ApeKI GCWGC 9 cut(s) 74, 162, 292, 358, 387, 465, 737, 885, 1001
ApoI RAATTY 1 cut(s) 610
ArsI GACNNNNNNTTYG 2 cut(s) 160, 192
AspLEI GCGC 2 cut(s) 74, 358
AspS9I GGNCC 3 cut(s) 773, 833, 905
AsuHPI GGTGA 2 cut(s) 86, 921
AsuII TTCGAA 1 cut(s) 179
AsuNHI GCTAGC 1 cut(s) 1090
AvaII GGWCC 2 cut(s) 773, 833
BaeGI GKGCMC 1 cut(s) 655
BanII GRGCYC 3 cut(s) 290, 318, 480
BauI CACGAG 2 cut(s) 346, 374
BbrPI CACGTG 1 cut(s) 656
Bbv12I GWGCWC 1 cut(s) 318
BbvCI CCTCAGC 1 cut(s) 192
BbvI GCAGC 9 cut(s) 61, 149, 304, 345, 374, 452, 724, 872, 988
BccI CCATC 4 cut(s) 524, 544, 717, 749
BciT130I CCWGG 3 cut(s) 124, 187, 1053
BclI TGATCA 1 cut(s) 1201
BcoDI GTCTC 2 cut(s) 377, 735
BfaI CTAG 3 cut(s) 69, 681, 1091
BfmI CTRYAG 1 cut(s) 388
BfoI RGCGCY 2 cut(s) 75, 359
BfrI CTTAAG 2 cut(s) 440, 982
BfuAI ACCTGC 1 cut(s) 611
Bme1390I CCNGG 3 cut(s) 124, 187, 1053
Bme18I GGWCC 2 cut(s) 773, 833
BmgT120I GGNCC 3 cut(s) 773, 833, 905
BmrFI CCNGG 3 cut(s) 124, 187, 1053
BmrI ACTGGG 3 cut(s) 102, 138, 804
BmsI GCATC 3 cut(s) 140, 974, 1186
BmtI GCTAGC 1 cut(s) 1094
BmuI ACTGGG 3 cut(s) 102, 138, 804
BplI GAGNNNNNCTC 4 cut(s) 329, 361, 547, 579
BpmI CTGGAG 1 cut(s) 663
Bpu10I CCTNAGC 2 cut(s) 192, 510
Bpu14I TTCGAA 1 cut(s) 179
BpuEI CTTGAG 2 cut(s) 717, 1025
BsaAI YACGTR 3 cut(s) 368, 656, 779
BsaBI GATNNNNATC 1 cut(s) 1200
BsaI GGTCTC 1 cut(s) 377
BsaJI CCNNGG 3 cut(s) 185, 186, 1106
Bsc4I CCNNNNNNNGG 5 cut(s) 172, 434, 782, 1011, 1131
Bse1I ACTGG 5 cut(s) 25, 108, 144, 799, 1016
Bse3DI GCAATG 1 cut(s) 302
Bse8I GATNNNNATC 1 cut(s) 1200
BseBI CCWGG 3 cut(s) 124, 187, 1053
BseDI CCNNGG 3 cut(s) 185, 186, 1106
BseJI GATNNNNATC 1 cut(s) 1200
BseLI CCNNNNNNNGG 5 cut(s) 172, 434, 782, 1011, 1131
BseMI GCAATG 1 cut(s) 302
BseMII CTCAG 3 cut(s) 183, 1251, 1256
BseNI ACTGG 5 cut(s) 25, 108, 144, 799, 1016
BseSI GKGCMC 1 cut(s) 655
BseXI GCAGC 9 cut(s) 61, 149, 304, 345, 374, 452, 724, 872, 988
BseYI CCCAGC 1 cut(s) 434
BsgI GTGCAG 1 cut(s) 344
BshFI GGCC 7 cut(s) 122, 258, 666, 906, 1135, 1153, 1172
BsiHKAI GWGCWC 1 cut(s) 318
BsiSI CCGG 3 cut(s) 113, 166, 1132
BslI CCNNNNNNNGG 5 cut(s) 172, 434, 782, 1011, 1131
BsmAI GTCTC 2 cut(s) 377, 735
BsnI GGCC 7 cut(s) 122, 258, 666, 906, 1135, 1153, 1172
Bso31I GGTCTC 1 cut(s) 377
Bsp119I TTCGAA 1 cut(s) 179
Bsp1286I GDGCHC 4 cut(s) 290, 318, 480, 655
Bsp143I GATC 4 cut(s) 581, 702, 837, 1201
BspACI CCGC 6 cut(s) 116, 119, 255, 326, 384, 959
BspANI GGCC 7 cut(s) 122, 258, 666, 906, 1135, 1153, 1172
BspCNI CTCAG 3 cut(s) 184, 1252, 1255
BspMAI CTGCAG 1 cut(s) 392
BspMI ACCTGC 1 cut(s) 611
BspOI GCTAGC 1 cut(s) 1094
BspPI GGATC 1 cut(s) 710
BspT104I TTCGAA 1 cut(s) 179
BspTI CTTAAG 2 cut(s) 440, 982
BspTNI GGTCTC 1 cut(s) 377
BsrDI GCAATG 1 cut(s) 302
BsrI ACTGG 5 cut(s) 25, 108, 144, 799, 1016
BssECI CCNNGG 3 cut(s) 185, 186, 1106
BssMI GATC 4 cut(s) 581, 702, 837, 1201
BssNAI GTATAC 1 cut(s) 826
BssSI CACGAG 2 cut(s) 346, 374
BssT1I CCWWGG 1 cut(s) 1106
Bst1107I GTATAC 1 cut(s) 826
Bst2BI CACGAG 2 cut(s) 346, 374
Bst2UI CCWGG 3 cut(s) 124, 187, 1053
Bst4CI ACNGT 4 cut(s) 323, 398, 1064, 1182
Bst6I CTCTTC 2 cut(s) 531, 713
BstAFI CTTAAG 2 cut(s) 440, 982
BstBAI YACGTR 3 cut(s) 368, 656, 779
BstBI TTCGAA 1 cut(s) 179
BstC8I GCNNGC 4 cut(s) 160, 290, 392, 1092
BstDEI CTNAG 4 cut(s) 192, 510, 1242, 1260
BstH2I RGCGCY 2 cut(s) 75, 359
BstHHI GCGC 2 cut(s) 74, 358
BstKTI GATC 4 cut(s) 584, 705, 840, 1204
BstMAI GTCTC 2 cut(s) 377, 735
BstMBI GATC 4 cut(s) 581, 702, 837, 1201
BstMWI GCNNNNNNNGC 7 cut(s) 128, 159, 215, 285, 301, 560, 1226
BstNI CCWGG 3 cut(s) 124, 187, 1053
BstNSI RCATGY 1 cut(s) 885
BstSCI CCNGG 3 cut(s) 122, 185, 1051
BstSFI CTRYAG 1 cut(s) 388
BstSLI GKGCMC 1 cut(s) 655
BstV1I GCAGC 9 cut(s) 61, 149, 304, 345, 374, 452, 724, 872, 988
BstZ17I GTATAC 1 cut(s) 826
BsuRI GGCC 7 cut(s) 122, 258, 666, 906, 1135, 1153, 1172
BtsIMutI CAGTG 3 cut(s) 328, 978, 1009
BveI ACCTGC 1 cut(s) 611
Cac8I GCNNGC 4 cut(s) 160, 290, 392, 1092
CfoI GCGC 2 cut(s) 74, 358
Cfr13I GGNCC 3 cut(s) 773, 833, 905
CviAII CATG 3 cut(s) 648, 882, 1086
DdeI CTNAG 4 cut(s) 192, 510, 1242, 1260
DpnI GATC 4 cut(s) 583, 704, 839, 1203
DpnII GATC 4 cut(s) 581, 702, 837, 1201
EaeI YGGCCR 2 cut(s) 120, 1133
Eam1104I CTCTTC 2 cut(s) 531, 713
EarI CTCTTC 2 cut(s) 531, 713
Ecl136II GAGCTC 1 cut(s) 316
Eco130I CCWWGG 1 cut(s) 1106
Eco147I AGGCCT 1 cut(s) 1153
Eco24I GRGCYC 3 cut(s) 290, 318, 480
Eco31I GGTCTC 1 cut(s) 377
Eco32I GATATC 1 cut(s) 1129
Eco47I GGWCC 2 cut(s) 773, 833
Eco47III AGCGCT 1 cut(s) 73
Eco53kI GAGCTC 1 cut(s) 316
Eco57I CTGAAG 1 cut(s) 954
Eco72I CACGTG 1 cut(s) 656
EcoICRI GAGCTC 1 cut(s) 316
EcoO109I RGGNCCY 1 cut(s) 905
EcoRII CCWGG 3 cut(s) 122, 185, 1051
EcoRV GATATC 1 cut(s) 1129
EcoT14I CCWWGG 1 cut(s) 1106
EcoT38I GRGCYC 3 cut(s) 290, 318, 480
ErhI CCWWGG 1 cut(s) 1106
FaeI CATG 3 cut(s) 651, 885, 1089
FalI AAGNNNNNCTT 2 cut(s) 849, 881
FatI CATG 3 cut(s) 647, 881, 1085
FbaI TGATCA 1 cut(s) 1201
FblI GTMKAC 1 cut(s) 825
FriOI GRGCYC 3 cut(s) 290, 318, 480
FspBI CTAG 3 cut(s) 69, 681, 1091
GlaI GCGC 2 cut(s) 73, 357
GsaI CCCAGC 1 cut(s) 438
GsuI CTGGAG 1 cut(s) 663
HaeII RGCGCY 2 cut(s) 75, 359
HaeIII GGCC 7 cut(s) 122, 258, 666, 906, 1135, 1153, 1172
HapII CCGG 3 cut(s) 113, 166, 1132
HhaI GCGC 2 cut(s) 74, 358
Hin1II CATG 3 cut(s) 651, 885, 1089
Hin6I GCGC 2 cut(s) 72, 356
HinP1I GCGC 2 cut(s) 72, 356
HincII GTYRAC 1 cut(s) 424
HindII GTYRAC 1 cut(s) 424
HinfI GANTC 3 cut(s) 344, 812, 1262
HpaII CCGG 3 cut(s) 113, 166, 1132
HphI GGTGA 2 cut(s) 86, 921
Hpy166II GTNNAC 2 cut(s) 424, 826
Hpy188I TCNGA 6 cut(s) 530, 581, 837, 1060, 1212, 1245
Hpy188III TCNNGA 6 cut(s) 199, 642, 700, 715, 853, 1259
Hpy8I GTNNAC 2 cut(s) 424, 826
HpyAV CCTTC 4 cut(s) 40, 304, 578, 1016
HpyCH4III ACNGT 4 cut(s) 323, 398, 1064, 1182
HpyCH4IV ACGT 3 cut(s) 367, 655, 778
HpyCH4V TGCA 4 cut(s) 361, 390, 620, 740
HpyF10VI GCNNNNNNNGC 7 cut(s) 128, 159, 215, 285, 301, 560, 1226
HpyF3I CTNAG 4 cut(s) 192, 510, 1242, 1260
HpySE526I ACGT 3 cut(s) 367, 655, 778
Hsp92II CATG 3 cut(s) 651, 885, 1089
HspAI GCGC 2 cut(s) 72, 356
Ksp22I TGATCA 1 cut(s) 1201
Kzo9I GATC 4 cut(s) 581, 702, 837, 1201
LmnI GCTCC 3 cut(s) 313, 582, 644
Lsp1109I GCAGC 9 cut(s) 61, 149, 304, 345, 374, 452, 724, 872, 988
LweI GCATC 3 cut(s) 140, 974, 1186
MaeI CTAG 3 cut(s) 69, 681, 1091
MaeII ACGT 3 cut(s) 367, 655, 778
MaeIII GTNAC 2 cut(s) 1018, 1159
MalI GATC 4 cut(s) 583, 704, 839, 1203
MboI GATC 4 cut(s) 581, 702, 837, 1201
MboII GAAGA 4 cut(s) 548, 730, 761, 960
MhlI GDGCHC 4 cut(s) 290, 318, 480, 655
MluCI AATT 4 cut(s) 99, 484, 610, 1113
MlyI GAGTC 2 cut(s) 338, 1271
MnlI CCTC 9 cut(s) 76, 187, 331, 438, 532, 549, 776, 1063, 1251
MseI TTAA 5 cut(s) 441, 950, 983, 1116, 1272
MslI CAYNNNNRTG 1 cut(s) 366
MspA1I CMGCKG 1 cut(s) 1001
MspCI CTTAAG 2 cut(s) 440, 982
MspI CCGG 3 cut(s) 113, 166, 1132
MspR9I CCNGG 3 cut(s) 124, 187, 1053
MvaI CCWGG 3 cut(s) 124, 187, 1053
MwoI GCNNNNNNNGC 7 cut(s) 128, 159, 215, 285, 301, 560, 1226
NdeII GATC 4 cut(s) 581, 702, 837, 1201
NheI GCTAGC 1 cut(s) 1090
NlaIII CATG 3 cut(s) 651, 885, 1089
NmuCI GTSAC 2 cut(s) 1018, 1159
NspI RCATGY 1 cut(s) 885
NspV TTCGAA 1 cut(s) 179
OliI CACNNNNGTG 1 cut(s) 366
PasI CCCWGGG 1 cut(s) 186
PceI AGGCCT 1 cut(s) 1153
PcsI WCGNNNNNNNCGW 1 cut(s) 176
PfeI GAWTC 1 cut(s) 812
PleI GAGTC 2 cut(s) 338, 1270
PmaCI CACGTG 1 cut(s) 656
PmlI CACGTG 1 cut(s) 656
PpsI GAGTC 2 cut(s) 338, 1270
Ppu21I YACGTR 3 cut(s) 368, 656, 779
Psp124BI GAGCTC 1 cut(s) 318
Psp6I CCWGG 3 cut(s) 122, 185, 1051
PspCI CACGTG 1 cut(s) 656
PspFI CCCAGC 1 cut(s) 434
PspGI CCWGG 3 cut(s) 122, 185, 1051
PspPI GGNCC 3 cut(s) 773, 833, 905
PstI CTGCAG 1 cut(s) 392
PvuII CAGCTG 1 cut(s) 1001
RseI CAYNNNNRTG 1 cut(s) 366
SacI GAGCTC 1 cut(s) 318
SaqAI TTAA 5 cut(s) 441, 950, 983, 1116, 1272
Sau3AI GATC 4 cut(s) 581, 702, 837, 1201
Sau96I GGNCC 3 cut(s) 773, 833, 905
SchI GAGTC 2 cut(s) 338, 1271
ScrFI CCNGG 3 cut(s) 124, 187, 1053
SduI GDGCHC 4 cut(s) 290, 318, 480, 655
SfaNI GCATC 3 cut(s) 140, 974, 1186
SfcI CTRYAG 1 cut(s) 388
SfuI TTCGAA 1 cut(s) 179
SinI GGWCC 2 cut(s) 773, 833
SmiMI CAYNNNNRTG 1 cut(s) 366
SmlI CTYRAG 4 cut(s) 440, 732, 982, 1040
SmoI CTYRAG 4 cut(s) 440, 732, 982, 1040
Sse9I AATT 4 cut(s) 99, 484, 610, 1113
SseBI AGGCCT 1 cut(s) 1153
SsiI CCGC 6 cut(s) 116, 119, 255, 326, 384, 959
SspMI CTAG 3 cut(s) 69, 681, 1091
SstI GAGCTC 1 cut(s) 318
StuI AGGCCT 1 cut(s) 1153
StyD4I CCNGG 3 cut(s) 122, 185, 1051
StyI CCWWGG 1 cut(s) 1106
TaaI ACNGT 4 cut(s) 323, 398, 1064, 1182
TaiI ACGT 3 cut(s) 370, 658, 781
TaqI TCGA 3 cut(s) 179, 318, 1074
TasI AATT 4 cut(s) 99, 484, 610, 1113
TauI GCSGC 4 cut(s) 119, 122, 258, 387
TfiI GAWTC 1 cut(s) 812
Tru1I TTAA 5 cut(s) 441, 950, 983, 1116, 1272
Tru9I TTAA 5 cut(s) 441, 950, 983, 1116, 1272
TscAI CASTG 3 cut(s) 328, 978, 1016
TseFI GTSAC 2 cut(s) 1018, 1159
TseI GCWGC 9 cut(s) 74, 162, 292, 358, 387, 465, 737, 885, 1001
Tsp45I GTSAC 2 cut(s) 1018, 1159
TspDTI ATGAA 3 cut(s) 17, 819, 953
TspRI CASTG 3 cut(s) 328, 978, 1016
Vha464I CTTAAG 2 cut(s) 440, 982
VpaK11BI GGWCC 2 cut(s) 773, 833
XapI RAATTY 1 cut(s) 610
XceI RCATGY 1 cut(s) 885
XmiI GTMKAC 1 cut(s) 825
XspI CTAG 3 cut(s) 69, 681, 1091
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.