pycom111g05390

first, biotin carboxylase catalyzes the carboxylation of the carrier protein and then the transcarboxylase transfers the carboxyl group to form malonyl-CoA

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_111
Physical Location & Seq
Forward (+)
3454142 .. 3454813
672 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom111g05390.1

Sequence Viewer

Length: 207 bp
ATGGCTTCCTTCACAGTTCCCTGTCCCAAGGCTTGCTCCGCCCCCGTTACCCGCCTCGGCTCCTCCGCCCAGCCGTCGCAGCCGCAGCAGTACCTCCTCTCCTTCCACAACTGCCTCAATCGCTGCCCCATTCCCTCTCTGCAGATTTCTGGCCTTCAGCTCCGTCAGGAAGCAATCTTCTTCCTGGAAGGTGCAGGCACAGCTTAA

Protein Analysis

69

Amino Acids

7.28

Weight (kDa)

8.51

Isoelectric Point (pI)

72.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 39, 52, 66, 83
AcuI CTGAAG 1 cut(s) 140
AfaI GTAC 1 cut(s) 92
AjnI CCWGG 1 cut(s) 183
AluBI AGCT 2 cut(s) 160, 203
AluI AGCT 2 cut(s) 160, 203
AoxI GGCC 1 cut(s) 151
ApeKI GCWGC 3 cut(s) 79, 85, 123
BbvI GCAGC 3 cut(s) 91, 97, 110
BceAI ACGGC 1 cut(s) 58
BciT130I CCWGG 1 cut(s) 185
BfmI CTRYAG 1 cut(s) 140
BisI GCNGC 4 cut(s) 80, 83, 86, 124
BlsI GCNGC 4 cut(s) 81, 84, 87, 125
Bme1390I CCNGG 1 cut(s) 185
BmiI GGNNCC 1 cut(s) 61
BmrFI CCNGG 1 cut(s) 185
BsaJI CCNNGG 2 cut(s) 27, 55
BsaXI ACNNNNNCTCC 2 cut(s) 83, 113
BseBI CCWGG 1 cut(s) 185
BseDI CCNNGG 2 cut(s) 27, 55
BseRI GAGGAG 2 cut(s) 52, 86
BseXI GCAGC 3 cut(s) 91, 97, 110
BseYI CCCAGC 1 cut(s) 69
BshFI GGCC 1 cut(s) 153
BslFI GGGAC 1 cut(s) 9
BsmFI GGGAC 1 cut(s) 9
BsnI GGCC 1 cut(s) 153
BspACI CCGC 4 cut(s) 39, 52, 66, 83
BspANI GGCC 1 cut(s) 153
BspLI GGNNCC 1 cut(s) 61
BspMAI CTGCAG 1 cut(s) 144
BssECI CCNNGG 2 cut(s) 27, 55
BssT1I CCWWGG 1 cut(s) 27
Bst2UI CCWGG 1 cut(s) 185
Bst4CI ACNGT 1 cut(s) 16
BstC8I GCNNGC 2 cut(s) 34, 196
BstMWI GCNNNNNNNGC 5 cut(s) 38, 79, 85, 120, 200
BstNI CCWGG 1 cut(s) 185
BstSCI CCNGG 1 cut(s) 183
BstSFI CTRYAG 1 cut(s) 140
BstV1I GCAGC 3 cut(s) 91, 97, 110
BsuRI GGCC 1 cut(s) 153
Cac8I GCNNGC 2 cut(s) 34, 196
Csp6I GTAC 1 cut(s) 91
CviJI RGCY 8 cut(s) 5, 32, 60, 73, 82, 153, 160, 203
CviKI_1 RGCY 8 cut(s) 5, 32, 60, 73, 82, 153, 160, 203
CviQI GTAC 1 cut(s) 91
EciI GGCGGA 2 cut(s) 28, 55
Eco130I CCWWGG 1 cut(s) 27
Eco57I CTGAAG 1 cut(s) 140
EcoRII CCWGG 1 cut(s) 183
EcoT14I CCWWGG 1 cut(s) 27
ErhI CCWWGG 1 cut(s) 27
FaqI GGGAC 1 cut(s) 9
FauI CCCGC 1 cut(s) 59
Fnu4HI GCNGC 4 cut(s) 80, 83, 86, 124
Fsp4HI GCNGC 4 cut(s) 80, 83, 86, 124
GluI GCNGC 4 cut(s) 80, 83, 86, 124
GsaI CCCAGC 1 cut(s) 73
HaeIII GGCC 1 cut(s) 153
Hpy188III TCNNGA 1 cut(s) 167
Hpy99I CGWCG 1 cut(s) 79
HpyAV CCTTC 4 cut(s) 19, 112, 164, 182
HpyCH4III ACNGT 1 cut(s) 16
HpyCH4V TGCA 2 cut(s) 142, 194
HpyF10VI GCNNNNNNNGC 5 cut(s) 38, 79, 85, 120, 200
LmnI GCTCC 3 cut(s) 41, 65, 165
LpnPI CCDG 7 cut(s) 34, 83, 135, 152, 170, 180, 197
Lsp1109I GCAGC 3 cut(s) 91, 97, 110
MaeIII GTNAC 1 cut(s) 46
MboII GAAGA 2 cut(s) 169, 172
MnlI CCTC 6 cut(s) 65, 73, 104, 107, 125, 145
MseI TTAA 1 cut(s) 205
MspR9I CCNGG 1 cut(s) 185
MvaI CCWGG 1 cut(s) 185
MwoI GCNNNNNNNGC 5 cut(s) 38, 79, 85, 120, 200
NlaIV GGNNCC 1 cut(s) 61
NmeAIII GCCGAG 1 cut(s) 36
PfoI TCCNGGA 1 cut(s) 183
PkrI GCNGC 4 cut(s) 81, 84, 87, 125
Psp6I CCWGG 1 cut(s) 183
PspFI CCCAGC 1 cut(s) 69
PspGI CCWGG 1 cut(s) 183
PspN4I GGNNCC 1 cut(s) 61
PstI CTGCAG 1 cut(s) 144
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
SaqAI TTAA 1 cut(s) 205
SatI GCNGC 4 cut(s) 80, 83, 86, 124
ScrFI CCNGG 1 cut(s) 185
SetI ASST 4 cut(s) 96, 162, 193, 205
SfcI CTRYAG 1 cut(s) 140
SsiI CCGC 4 cut(s) 39, 52, 66, 83
StyD4I CCNGG 1 cut(s) 183
StyI CCWWGG 1 cut(s) 27
TaaI ACNGT 1 cut(s) 16
TauI GCSGC 1 cut(s) 85
Tru1I TTAA 1 cut(s) 205
Tru9I TTAA 1 cut(s) 205
TseI GCWGC 3 cut(s) 79, 85, 123
TspGWI ACGGA 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.