pycom11g14420

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
14363401 .. 14366238
2838 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 327 bp
ATGTCAAGACCAGTGCTGCTTGTTTTTCTGCTTCTTATTCTCATAATCACTTCTCAGTTTGAATGGAAGCAACAACTTGTGCCTGATCTTGACACAACTCCAAGCATTTCCGAAAAGCAGAATCAAAACTCGAATAGGGAAGAAGTTGTAAAAGAGAAGATCATATTATTGCAAGAAAAGAACATCCAGAGACTTAATGAGCTTGTTCGCAGTCTTCGGGAACAGTTGGTACAGTGTAGGAGCAAGAATGTGACAAAAAATCAAACTGTAAGCTTCCTAACAGAACGTGTGACGGAACTTGAACGACATCAGATGTTTGATGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

12.82

Weight (kDa)

6.6

Isoelectric Point (pI)

57.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 231
AflIII ACRYGT 1 cut(s) 286
AgsI TTSAA 2 cut(s) 62, 302
AluBI AGCT 2 cut(s) 202, 273
AluI AGCT 2 cut(s) 202, 273
Alw26I GTCTC 1 cut(s) 184
ApeKI GCWGC 1 cut(s) 16
BbsI GAAGAC 1 cut(s) 206
BbvI GCAGC 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 184
BfaI CTAG 1 cut(s) 325
BisI GCNGC 1 cut(s) 17
BlsI GCNGC 1 cut(s) 18
BpiI GAAGAC 1 cut(s) 206
Bse1I ACTGG 1 cut(s) 11
BseGI GGATG 1 cut(s) 183
BseMII CTCAG 1 cut(s) 68
BseNI ACTGG 1 cut(s) 11
BseXI GCAGC 1 cut(s) 3
BsmAI GTCTC 1 cut(s) 184
Bsp143I GATC 2 cut(s) 85, 159
BspCNI CTCAG 1 cut(s) 67
BsrI ACTGG 1 cut(s) 11
BssMI GATC 2 cut(s) 85, 159
Bst4CI ACNGT 3 cut(s) 225, 234, 268
BstDEI CTNAG 1 cut(s) 54
BstF5I GGATG 1 cut(s) 183
BstKTI GATC 2 cut(s) 88, 162
BstMAI GTCTC 1 cut(s) 184
BstMBI GATC 2 cut(s) 85, 159
BstV1I GCAGC 1 cut(s) 3
BstV2I GAAGAC 1 cut(s) 206
BtsCI GGATG 1 cut(s) 183
BtsIMutI CAGTG 2 cut(s) 18, 239
Csp6I GTAC 1 cut(s) 230
CviJI RGCY 2 cut(s) 202, 273
CviKI_1 RGCY 2 cut(s) 202, 273
CviQI GTAC 1 cut(s) 230
DdeI CTNAG 1 cut(s) 54
DpnI GATC 2 cut(s) 87, 161
DpnII GATC 2 cut(s) 85, 159
FaiI YATR 2 cut(s) 44, 164
Fnu4HI GCNGC 1 cut(s) 17
FokI GGATG 1 cut(s) 170
Fsp4HI GCNGC 1 cut(s) 17
FspBI CTAG 1 cut(s) 325
GluI GCNGC 1 cut(s) 17
HindIII AAGCTT 1 cut(s) 271
HinfI GANTC 1 cut(s) 121
Hpy188I TCNGA 2 cut(s) 112, 312
Hpy188III TCNNGA 4 cut(s) 6, 89, 187, 218
HpyCH4III ACNGT 3 cut(s) 225, 234, 268
HpyCH4IV ACGT 1 cut(s) 286
HpyCH4V TGCA 1 cut(s) 172
HpyF3I CTNAG 1 cut(s) 54
HpySE526I ACGT 1 cut(s) 286
Kzo9I GATC 2 cut(s) 85, 159
LmnI GCTCC 1 cut(s) 240
LpnPI CCDG 3 cut(s) 24, 96, 200
Lsp1109I GCAGC 1 cut(s) 3
MaeI CTAG 1 cut(s) 325
MaeII ACGT 1 cut(s) 286
MaeIII GTNAC 2 cut(s) 250, 289
MalI GATC 2 cut(s) 87, 161
MboI GATC 2 cut(s) 85, 159
MboII GAAGA 3 cut(s) 152, 169, 206
MseI TTAA 1 cut(s) 195
NdeII GATC 2 cut(s) 85, 159
NmuCI GTSAC 2 cut(s) 250, 289
PfeI GAWTC 1 cut(s) 121
PkrI GCNGC 1 cut(s) 18
PsrI GAACNNNNNNTAC 2 cut(s) 213, 245
RsaI GTAC 1 cut(s) 231
RsaNI GTAC 1 cut(s) 230
SaqAI TTAA 1 cut(s) 195
SatI GCNGC 1 cut(s) 17
Sau3AI GATC 2 cut(s) 85, 159
SetI ASST 3 cut(s) 204, 275, 289
SspMI CTAG 1 cut(s) 325
TaaI ACNGT 3 cut(s) 225, 234, 268
TaiI ACGT 1 cut(s) 289
TaqI TCGA 1 cut(s) 131
TfiI GAWTC 1 cut(s) 121
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TscAI CASTG 2 cut(s) 18, 239
TseFI GTSAC 2 cut(s) 250, 289
TseI GCWGC 1 cut(s) 16
Tsp45I GTSAC 2 cut(s) 250, 289
TspGWI ACGGA 1 cut(s) 308
TspRI CASTG 2 cut(s) 18, 239
XspI CTAG 1 cut(s) 325
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.