Rmu_sc0003093.1_g000027

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003093.1
Physical Location & Seq
Forward (+)
128436 .. 130715
2280 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003093.1_g000027.1.cds

Sequence Viewer

Length: 303 bp
atgcccttcttcttcttcttcttcagctcagatccatttgaatggaagcaacaatatgggaatgacgagccgagtccaaacccttcaaagaaacagcaatatatatctgaaagggaagaagctgtgaaagaaaagattatactctctcaagagaaaaatatacagaaacttaatgagctcgtgcggagtcttcgagaacagttactacaatgtagaggtgaaagtgaggttgtcaatggcactgcaacacctttgaccgaacttctttctgacctcgaacgacatgcactcttggaggattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.74

Weight (kDa)

4.83

Isoelectric Point (pI)

63.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 184
AclWI GGATC 1 cut(s) 26
AcuI CTGAAG 1 cut(s) 7
AgsI TTSAA 2 cut(s) 41, 87
AluBI AGCT 3 cut(s) 27, 122, 178
AluI AGCT 3 cut(s) 27, 122, 178
Alw21I GWGCWC 1 cut(s) 180
AlwI GGATC 1 cut(s) 26
AsuHPI GGTGA 1 cut(s) 230
BanII GRGCYC 1 cut(s) 180
BauI CACGAG 1 cut(s) 179
BbsI GAAGAC 1 cut(s) 182
Bbv12I GWGCWC 1 cut(s) 180
BcgI CGANNNNNNTGC 2 cut(s) 266, 300
BpiI GAAGAC 1 cut(s) 182
BpuEI CTTGAG 1 cut(s) 132
BseMII CTCAG 1 cut(s) 42
BsiHKAI GWGCWC 1 cut(s) 180
Bsp1286I GDGCHC 1 cut(s) 180
Bsp143I GATC 1 cut(s) 31
BspACI CCGC 1 cut(s) 184
BspCNI CTCAG 1 cut(s) 41
BspPI GGATC 1 cut(s) 26
BssMI GATC 1 cut(s) 31
BssSI CACGAG 1 cut(s) 179
Bst2BI CACGAG 1 cut(s) 179
Bst4CI ACNGT 1 cut(s) 201
BstDEI CTNAG 1 cut(s) 28
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
BstNSI RCATGY 1 cut(s) 287
BstV2I GAAGAC 1 cut(s) 182
BstX2I RGATCY 1 cut(s) 31
BstXI CCANNNNNNTGG 1 cut(s) 42
BstYI RGATCY 1 cut(s) 31
BtsI GCAGTG 1 cut(s) 240
BtsIMutI CAGTG 1 cut(s) 240
CviAII CATG 1 cut(s) 284
CviJI RGCY 4 cut(s) 27, 70, 122, 178
CviKI_1 RGCY 4 cut(s) 27, 70, 122, 178
DdeI CTNAG 1 cut(s) 28
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
Ecl136II GAGCTC 1 cut(s) 178
Eco24I GRGCYC 1 cut(s) 180
Eco53kI GAGCTC 1 cut(s) 178
Eco57I CTGAAG 1 cut(s) 7
EcoICRI GAGCTC 1 cut(s) 178
EcoT38I GRGCYC 1 cut(s) 180
FaeI CATG 1 cut(s) 287
FaiI YATR 6 cut(s) 57, 102, 104, 140, 161, 285
FatI CATG 1 cut(s) 283
FriOI GRGCYC 1 cut(s) 180
Hin1II CATG 1 cut(s) 287
HinfI GANTC 2 cut(s) 73, 187
HphI GGTGA 1 cut(s) 230
Hpy188I TCNGA 3 cut(s) 31, 109, 271
Hpy188III TCNNGA 2 cut(s) 149, 194
HpyAV CCTTC 2 cut(s) 16, 93
HpyCH4III ACNGT 1 cut(s) 201
HpyCH4V TGCA 2 cut(s) 245, 287
HpyF3I CTNAG 1 cut(s) 28
Hsp92II CATG 1 cut(s) 287
Kzo9I GATC 1 cut(s) 31
MaeIII GTNAC 1 cut(s) 201
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MboII GAAGA 6 cut(s) 4, 7, 10, 13, 128, 182
MflI RGATCY 1 cut(s) 31
MhlI GDGCHC 1 cut(s) 180
MlyI GAGTC 2 cut(s) 82, 196
MnlI CCTC 4 cut(s) 209, 220, 284, 289
MseI TTAA 1 cut(s) 171
MslI CAYNNNNRTG 1 cut(s) 40
NdeII GATC 1 cut(s) 31
NlaIII CATG 1 cut(s) 287
NmeAIII GCCGAG 1 cut(s) 96
NspI RCATGY 1 cut(s) 287
PleI GAGTC 2 cut(s) 81, 195
PpsI GAGTC 2 cut(s) 81, 195
Psp124BI GAGCTC 1 cut(s) 180
PsrI GAACNNNNNNTAC 2 cut(s) 189, 221
PsuI RGATCY 1 cut(s) 31
RseI CAYNNNNRTG 1 cut(s) 40
SacI GAGCTC 1 cut(s) 180
SaqAI TTAA 1 cut(s) 171
Sau3AI GATC 1 cut(s) 31
SchI GAGTC 2 cut(s) 82, 196
SduI GDGCHC 1 cut(s) 180
SetI ASST 7 cut(s) 29, 124, 180, 220, 231, 253, 276
SgeI CNNG 8 cut(s) 79, 84, 161, 191, 193, 206, 287, 296
SmiMI CAYNNNNRTG 1 cut(s) 40
SmlI CTYRAG 1 cut(s) 147
SmoI CTYRAG 1 cut(s) 147
SsiI CCGC 1 cut(s) 184
SstI GAGCTC 1 cut(s) 180
TaaI ACNGT 1 cut(s) 201
TaqI TCGA 2 cut(s) 193, 276
TaqII GACCGA 1 cut(s) 272
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
TscAI CASTG 1 cut(s) 247
TspRI CASTG 1 cut(s) 247
XceI RCATGY 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.