pycom11g27680

Cotton fibre expressed protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
OG0016068
Physical Location & Seq
Reverse (-)
29859823 .. 29860551
729 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 729 bp
ATGACATTGATGAAGATGTCGAAGAAGAAATCATCAAATGGTAATGATGATGACGTCGGTCGACCAAGACCAACACATAGAGCGTGGAAGCTGCTGCGTCTGGCATTGCTTTGGGCAAGAAAGGGCGGTGTTTTCAGGCGACGCCTCATGATGGAACTACGCGTCGTCCCCAAGTTGCTCAAGAGTAGCTTCGTCCACATGCTTATGCACATGCAGCAGCAGAAGCAGCAGGAGCGGCAGCAGTATTACTTCGAGCGGCAGCTGTCGTTCGACAAGACCCCAATTTTCCCCACCCTCAAAACCAAAACCAGCTGTTCCCGCTCCTCCTTCATGTGCTTCATCAACAACATCCCTTGCCTAAACGCACCATTAGCACTTGATTATTTTGATGATGATCAAGTCGACATGATCATCAATAACCACGGATATCAATCAAACGATTGCTGCTACTGCTACTATGACGATGATGATGAAGACGATGCTAGTACTGCAAGACAGAGCTTTCTTATCAAATGTGATGAGAAGGATGATGGCCGAGATATTATTCAGGATGATGAGGAAGAAAGGGTTACTCTTTCTCCTGCTACAGCTTATAAAAACAATATTTACGAGGAGTTAGAGGAATCGGTTGACATGAAGGCAGATGAGTTCATAGCTAAGTTCTACCAGCAAATGAAGCTCCAAAGACAGATTTCATACCGACACCACACTCAGAACCACACATGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF761

Protein Analysis

243

Amino Acids

28.71

Weight (kDa)

6.39

Isoelectric Point (pI)

56.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF761 PF05553 208 - 238 4.6e-14 Cotton fibre expressed protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016068)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G02170 AT5G38700
fragaria_vesca FvH4_5g39610
malus_domestica MD03G1297400.v1.1 MD11G1317200.v1.1
prunus_persica Prupe.8G269600_v2.0.a1
pyrus_communis pycom03g23590 pycom11g27680
rosa_chinensis RchiOBHm_Chr7g0241911
rosa_laevigata RLG00000000530
rosa_multiflora Rmu_ssc0000315.1_g000001
rosa_roxburghii Rroxscaffold_3G00218490
rosa_rugosa Rorug07G0348600
rosa_samantha Rh7DG488200
rosa_wichuraiana Rw7G042510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 594
AatII GACGTC 1 cut(s) 57
AccBSI CCGCTC 3 cut(s) 235, 256, 321
AccI GTMKAC 2 cut(s) 61, 402
AccII CGCG 1 cut(s) 162
AciI CCGC 4 cut(s) 126, 235, 256, 319
AcoI YGGCCR 1 cut(s) 532
AcyI GRCGYC 2 cut(s) 54, 142
AfaI GTAC 1 cut(s) 487
AfiI CCNNNNNNNGG 1 cut(s) 151
AflIII ACRYGT 2 cut(s) 160, 722
AluBI AGCT 8 cut(s) 91, 189, 262, 312, 501, 590, 656, 679
AluI AGCT 8 cut(s) 91, 189, 262, 312, 501, 590, 656, 679
AoxI GGCC 1 cut(s) 532
ApeKI GCWGC 8 cut(s) 91, 94, 214, 217, 226, 238, 259, 444
BbsI GAAGAC 1 cut(s) 480
BbvI GCAGC 8 cut(s) 78, 81, 226, 229, 238, 250, 271, 431
BccI CCATC 2 cut(s) 145, 524
BclI TGATCA 2 cut(s) 394, 408
BfaI CTAG 1 cut(s) 483
BfmI CTRYAG 1 cut(s) 585
BmcAI AGTACT 1 cut(s) 487
BmsI GCATC 1 cut(s) 469
BoxI GACNNNNGTC 1 cut(s) 57
BpiI GAAGAC 1 cut(s) 480
BpuEI CTTGAG 1 cut(s) 164
BsaBI GATNNNNATC 2 cut(s) 393, 430
BsaHI GRCGYC 2 cut(s) 54, 142
BsaJI CCNNGG 1 cut(s) 421
BsaXI ACNNNNNCTCC 2 cut(s) 562, 592
Bsc4I CCNNNNNNNGG 1 cut(s) 151
Bse3DI GCAATG 1 cut(s) 104
Bse8I GATNNNNATC 2 cut(s) 393, 430
BseDI CCNNGG 1 cut(s) 421
BseGI GGATG 3 cut(s) 348, 532, 556
BseJI GATNNNNATC 2 cut(s) 393, 430
BseLI CCNNNNNNNGG 1 cut(s) 151
BseMI GCAATG 1 cut(s) 104
BseMII CTCAG 1 cut(s) 725
BseRI GAGGAG 2 cut(s) 313, 626
BseXI GCAGC 8 cut(s) 78, 81, 226, 229, 238, 250, 271, 431
Bsh1236I CGCG 1 cut(s) 162
Bsh1285I CGRYCG 1 cut(s) 61
BshFI GGCC 1 cut(s) 534
BsiEI CGRYCG 1 cut(s) 61
BslFI GGGAC 1 cut(s) 152
BslI CCNNNNNNNGG 1 cut(s) 151
BsmFI GGGAC 1 cut(s) 152
BsnI GGCC 1 cut(s) 534
Bsp143I GATC 2 cut(s) 394, 408
BspACI CCGC 4 cut(s) 126, 235, 256, 319
BspANI GGCC 1 cut(s) 534
BspCNI CTCAG 1 cut(s) 724
BspFNI CGCG 1 cut(s) 162
BspHI TCATGA 1 cut(s) 147
BsrBI CCGCTC 3 cut(s) 235, 256, 321
BsrDI GCAATG 1 cut(s) 104
BssECI CCNNGG 1 cut(s) 421
BssMI GATC 2 cut(s) 394, 408
BssNI GRCGYC 2 cut(s) 54, 142
BstACI GRCGYC 2 cut(s) 54, 142
BstDEI CTNAG 2 cut(s) 657, 711
BstDSI CCRYGG 1 cut(s) 421
BstF5I GGATG 3 cut(s) 348, 532, 556
BstFNI CGCG 1 cut(s) 162
BstKTI GATC 2 cut(s) 397, 411
BstMBI GATC 2 cut(s) 394, 408
BstMCI CGRYCG 1 cut(s) 61
BstNSI RCATGY 3 cut(s) 202, 214, 726
BstPAI GACNNNNGTC 1 cut(s) 57
BstSFI CTRYAG 1 cut(s) 585
BstUI CGCG 1 cut(s) 162
BstV1I GCAGC 8 cut(s) 78, 81, 226, 229, 238, 250, 271, 431
BstV2I GAAGAC 1 cut(s) 480
BsuRI GGCC 1 cut(s) 534
BtgI CCRYGG 1 cut(s) 421
BtsCI GGATG 3 cut(s) 348, 532, 556
CciI TCATGA 1 cut(s) 147
CseI GACGC 3 cut(s) 86, 150, 151
Csp6I GTAC 1 cut(s) 486
CviAII CATG 7 cut(s) 148, 199, 211, 331, 406, 634, 723
CviJI RGCY 9 cut(s) 91, 189, 262, 312, 501, 534, 590, 656, 679
CviKI_1 RGCY 9 cut(s) 91, 189, 262, 312, 501, 534, 590, 656, 679
CviQI GTAC 1 cut(s) 486
DdeI CTNAG 2 cut(s) 657, 711
DpnI GATC 2 cut(s) 396, 410
DpnII GATC 2 cut(s) 394, 408
EaeI YGGCCR 1 cut(s) 532
Eco32I GATATC 1 cut(s) 428
EcoRV GATATC 1 cut(s) 428
FaeI CATG 7 cut(s) 151, 202, 214, 334, 409, 637, 726
FalI AAGNNNNNCTT 2 cut(s) 173, 205
FaqI GGGAC 1 cut(s) 152
FatI CATG 7 cut(s) 147, 198, 210, 330, 405, 633, 722
FauI CCCGC 1 cut(s) 326
FbaI TGATCA 2 cut(s) 394, 408
FblI GTMKAC 2 cut(s) 61, 402
FokI GGATG 3 cut(s) 335, 539, 563
FspBI CTAG 1 cut(s) 483
HaeIII GGCC 1 cut(s) 534
HgaI GACGC 3 cut(s) 86, 150, 151
Hin1I GRCGYC 2 cut(s) 54, 142
Hin1II CATG 7 cut(s) 151, 202, 214, 334, 409, 637, 726
HincII GTYRAC 3 cut(s) 62, 403, 631
HindII GTYRAC 3 cut(s) 62, 403, 631
HinfI GANTC 1 cut(s) 623
Hpy166II GTNNAC 4 cut(s) 62, 196, 403, 631
Hpy188I TCNGA 1 cut(s) 714
Hpy188III TCNNGA 3 cut(s) 148, 181, 548
Hpy8I GTNNAC 4 cut(s) 62, 196, 403, 631
Hpy99I CGWCG 3 cut(s) 59, 144, 167
HpyAV CCTTC 3 cut(s) 337, 517, 631
HpyCH4IV ACGT 1 cut(s) 54
HpyCH4V TGCA 3 cut(s) 208, 214, 491
HpyF3I CTNAG 2 cut(s) 657, 711
HpySE526I ACGT 1 cut(s) 54
Hsp92I GRCGYC 2 cut(s) 54, 142
Hsp92II CATG 7 cut(s) 151, 202, 214, 334, 409, 637, 726
Ksp22I TGATCA 2 cut(s) 394, 408
Kzo9I GATC 2 cut(s) 394, 408
LmnI GCTCC 3 cut(s) 232, 326, 684
LpnPI CCDG 7 cut(s) 86, 121, 215, 322, 533, 594, 680
Lsp1109I GCAGC 8 cut(s) 78, 81, 226, 229, 238, 250, 271, 431
LweI GCATC 1 cut(s) 469
MaeI CTAG 1 cut(s) 483
MaeII ACGT 1 cut(s) 54
MaeIII GTNAC 1 cut(s) 568
MalI GATC 2 cut(s) 396, 410
MbiI CCGCTC 3 cut(s) 235, 256, 321
MboI GATC 2 cut(s) 394, 408
MboII GAAGA 5 cut(s) 25, 34, 37, 485, 572
MluCI AATT 1 cut(s) 282
MluI ACGCGT 1 cut(s) 160
MnlI CCTC 6 cut(s) 155, 305, 334, 550, 604, 613
MseI TTAA 1 cut(s) 727
MslI CAYNNNNRTG 1 cut(s) 203
MspA1I CMGCKG 2 cut(s) 262, 312
MvnI CGCG 1 cut(s) 162
NdeII GATC 2 cut(s) 394, 408
NlaIII CATG 7 cut(s) 151, 202, 214, 334, 409, 637, 726
NmeAIII GCCGAG 1 cut(s) 560
NspI RCATGY 3 cut(s) 202, 214, 726
PagI TCATGA 1 cut(s) 147
PciI ACATGT 1 cut(s) 722
PfeI GAWTC 1 cut(s) 623
PscI ACATGT 1 cut(s) 722
PshAI GACNNNNGTC 1 cut(s) 57
PsiI TTATAA 1 cut(s) 594
PvuII CAGCTG 2 cut(s) 262, 312
RsaI GTAC 1 cut(s) 487
RsaNI GTAC 1 cut(s) 486
RseI CAYNNNNRTG 1 cut(s) 203
SalI GTCGAC 2 cut(s) 60, 401
SaqAI TTAA 1 cut(s) 727
Sau3AI GATC 2 cut(s) 394, 408
ScaI AGTACT 1 cut(s) 487
SetI ASST 9 cut(s) 57, 93, 191, 264, 314, 503, 592, 658, 681
SfaNI GCATC 1 cut(s) 469
SfcI CTRYAG 1 cut(s) 585
SmiMI CAYNNNNRTG 1 cut(s) 203
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 1 cut(s) 282
SsiI CCGC 4 cut(s) 126, 235, 256, 319
SspI AATATT 1 cut(s) 604
SspMI CTAG 1 cut(s) 483
TaiI ACGT 1 cut(s) 57
TaqI TCGA 5 cut(s) 20, 61, 252, 270, 402
TaqII GACCGA 1 cut(s) 47
TasI AATT 1 cut(s) 282
TatI WGTACW 1 cut(s) 485
TauI GCSGC 2 cut(s) 238, 259
TfiI GAWTC 1 cut(s) 623
Tru1I TTAA 1 cut(s) 727
Tru9I TTAA 1 cut(s) 727
TseI GCWGC 8 cut(s) 91, 94, 214, 217, 226, 238, 259, 444
TspDTI ATGAA 8 cut(s) 26, 319, 328, 486, 640, 650, 684, 689
TspGWI ACGGA 1 cut(s) 438
XceI RCATGY 3 cut(s) 202, 214, 726
XmiI GTMKAC 2 cut(s) 61, 402
XspI CTAG 1 cut(s) 483
ZraI GACGTC 1 cut(s) 55
ZrmI AGTACT 1 cut(s) 487
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.