pycom12g22070

Subunit of the peripheral V1 complex of vacuolar ATPase essential for assembly or catalytic function. V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0012473
Physical Location & Seq
Forward (+)
23102066 .. 23103218
1153 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGATTGCTGATGAGGACACTGTGACCGGATTTTTGCTAGCTGGAGTGGGTAACGTTGACTTGCGAAGAAAGACAAATTATCTTATTGTTGATTCAAAAACAACAGTGAAACAAATTGAAGATGCATTCAAAGAGTTTACAACAAAGGACGACATTGCAATTGTCTTGATCAGCCAATATGTTGCAAACATGATAAGGTTTCTAGTCGATAGCTACAATAAGCCGGTTCCAGCTATTTTGGAAATCCCGTCCAAGGATCGATCCTTATGA

Protein Analysis

90

Amino Acids

9.99

Weight (kDa)

4.95

Isoelectric Point (pI)

37.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP-synt_F PF01990 2 - 87 1.9e-24 ATP synthase (F/14-kDa) subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012473)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G02620
fragaria_vesca FvH4_6g02960
malus_domestica MD04G1224300.v1.1 MD12G1241000.v1.1
prunus_persica Prupe.5G006500_v2.0.a1 Prupe.5G006500_v2.0.a1 Prupe.6G005500_v2.0.a1
pyrus_communis pycom04g19760 pycom12g22070
rosa_chinensis RchiOBHm_Chr3g0451151
rosa_laevigata RLG00000025685
rosa_multiflora Rmu_ssc0000028.1_g000004
rosa_roxburghii Rroxscaffold_6G00428620
rosa_rugosa Rorug02G0632000
rosa_samantha Rh3AG034800 Rh3BG035200 Rh3CG033700 Rh3DG034800
rosa_wichuraiana Rw3G002540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 54
AclWI GGATC 2 cut(s) 255, 264
AfiI CCNNNNNNNGG 1 cut(s) 253
AgsI TTSAA 3 cut(s) 96, 119, 130
AluBI AGCT 3 cut(s) 41, 213, 233
AluI AGCT 3 cut(s) 41, 213, 233
AlwI GGATC 2 cut(s) 255, 264
ArsI GACNNNNNNTTYG 2 cut(s) 16, 48
AsuNHI GCTAGC 1 cut(s) 37
BclI TGATCA 1 cut(s) 168
BfaI CTAG 2 cut(s) 38, 203
BmiI GGNNCC 1 cut(s) 228
BmsI GCATC 1 cut(s) 112
BmtI GCTAGC 1 cut(s) 41
BpmI CTGGAG 1 cut(s) 63
Bsa29I ATCGAT 1 cut(s) 259
BsaJI CCNNGG 1 cut(s) 252
BsaWI WCCGGW 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 253
Bse118I RCCGGY 1 cut(s) 223
Bse3DI GCAATG 1 cut(s) 153
BseCI ATCGAT 1 cut(s) 259
BseDI CCNNGG 1 cut(s) 252
BseLI CCNNNNNNNGG 1 cut(s) 253
BseMI GCAATG 1 cut(s) 153
BshVI ATCGAT 1 cut(s) 259
BsiSI CCGG 2 cut(s) 27, 224
BslI CCNNNNNNNGG 1 cut(s) 253
BsmI GAATGC 1 cut(s) 125
Bsp143I GATC 3 cut(s) 168, 256, 260
BspDI ATCGAT 1 cut(s) 259
BspLI GGNNCC 1 cut(s) 228
BspOI GCTAGC 1 cut(s) 41
BspPI GGATC 2 cut(s) 255, 264
BsrDI GCAATG 1 cut(s) 153
BsrFI RCCGGY 1 cut(s) 223
BssAI RCCGGY 1 cut(s) 223
BssECI CCNNGG 1 cut(s) 252
BssMI GATC 3 cut(s) 168, 256, 260
BssT1I CCWWGG 1 cut(s) 252
Bst4CI ACNGT 2 cut(s) 22, 106
BstC8I GCNNGC 1 cut(s) 39
BstKTI GATC 3 cut(s) 171, 259, 263
BstMBI GATC 3 cut(s) 168, 256, 260
Bsu15I ATCGAT 1 cut(s) 259
BsuTUI ATCGAT 1 cut(s) 259
BtsIMutI CAGTG 2 cut(s) 18, 111
Cac8I GCNNGC 1 cut(s) 39
Cfr10I RCCGGY 1 cut(s) 223
ClaI ATCGAT 1 cut(s) 259
CviAII CATG 1 cut(s) 190
CviJI RGCY 5 cut(s) 41, 174, 213, 223, 233
CviKI_1 RGCY 5 cut(s) 41, 174, 213, 223, 233
DpnI GATC 3 cut(s) 170, 258, 262
DpnII GATC 3 cut(s) 168, 256, 260
Eco130I CCWWGG 1 cut(s) 252
EcoT14I CCWWGG 1 cut(s) 252
EcoT22I ATGCAT 1 cut(s) 127
ErhI CCWWGG 1 cut(s) 252
FaeI CATG 1 cut(s) 193
FaiI YATR 3 cut(s) 180, 191, 268
FatI CATG 1 cut(s) 189
FbaI TGATCA 1 cut(s) 168
FspBI CTAG 2 cut(s) 38, 203
GsuI CTGGAG 1 cut(s) 63
HapII CCGG 2 cut(s) 27, 224
Hin1II CATG 1 cut(s) 193
HincII GTYRAC 1 cut(s) 58
HindII GTYRAC 1 cut(s) 58
HinfI GANTC 1 cut(s) 92
HpaII CCGG 2 cut(s) 27, 224
Hpy166II GTNNAC 2 cut(s) 58, 138
Hpy188III TCNNGA 1 cut(s) 166
Hpy8I GTNNAC 2 cut(s) 58, 138
HpyCH4III ACNGT 2 cut(s) 22, 106
HpyCH4IV ACGT 1 cut(s) 54
HpyCH4V TGCA 3 cut(s) 125, 158, 185
HpySE526I ACGT 1 cut(s) 54
Hsp92II CATG 1 cut(s) 193
Ksp22I TGATCA 1 cut(s) 168
Kzo9I GATC 3 cut(s) 168, 256, 260
LpnPI CCDG 4 cut(s) 27, 40, 237, 243
LweI GCATC 1 cut(s) 112
MaeI CTAG 2 cut(s) 38, 203
MaeII ACGT 1 cut(s) 54
MaeIII GTNAC 2 cut(s) 22, 50
MalI GATC 3 cut(s) 170, 258, 262
MboI GATC 3 cut(s) 168, 256, 260
MboII GAAGA 2 cut(s) 78, 131
MfeI CAATTG 1 cut(s) 159
MluCI AATT 3 cut(s) 76, 114, 159
MnlI CCTC 1 cut(s) 7
Mph1103I ATGCAT 1 cut(s) 127
MspI CCGG 2 cut(s) 27, 224
MunI CAATTG 1 cut(s) 159
Mva1269I GAATGC 1 cut(s) 125
NdeII GATC 3 cut(s) 168, 256, 260
NheI GCTAGC 1 cut(s) 37
NlaIII CATG 1 cut(s) 193
NlaIV GGNNCC 1 cut(s) 228
NmuCI GTSAC 1 cut(s) 22
NsiI ATGCAT 1 cut(s) 127
PctI GAATGC 1 cut(s) 125
PfeI GAWTC 1 cut(s) 92
Psp1406I AACGTT 1 cut(s) 54
PspN4I GGNNCC 1 cut(s) 228
Sau3AI GATC 3 cut(s) 168, 256, 260
SetI ASST 5 cut(s) 43, 57, 200, 215, 235
SfaNI GCATC 1 cut(s) 112
Sse9I AATT 3 cut(s) 76, 114, 159
SspMI CTAG 2 cut(s) 38, 203
StyI CCWWGG 1 cut(s) 252
TaaI ACNGT 2 cut(s) 22, 106
TaiI ACGT 1 cut(s) 57
TaqI TCGA 2 cut(s) 207, 259
TasI AATT 3 cut(s) 76, 114, 159
TfiI GAWTC 1 cut(s) 92
TscAI CASTG 2 cut(s) 25, 111
TseFI GTSAC 1 cut(s) 22
Tsp45I GTSAC 1 cut(s) 22
TspRI CASTG 2 cut(s) 25, 111
XspI CTAG 2 cut(s) 38, 203
Zsp2I ATGCAT 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.