pycom12g22130

Histidine kinase-like ATPases

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
23148558 .. 23148782
225 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 225 bp
ATGCTTATTTTCTCTGCAACTACCCCACCAACACCCATCAATTTCCACTTTTACCCACCTCTTTCCCCCTATTTCCCACAAACTCCCGCATCCCTGAAACCCAACGCCACTTCCACTCCCCGACCCCATGACCTCTTCGCCATTAACGCATTTGCACCTTCATCCTCCAAAACTCTAGAAGCCCCCCTACCCACCGCTTGCTACTTCACGTCACTTCAACTTTGA

Protein Analysis

75

Amino Acids

8.08

Weight (kDa)

7.94

Isoelectric Point (pI)

56.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 87, 195
AgsI TTSAA 1 cut(s) 218
AjiI CACGTC 1 cut(s) 210
BarI GAAGNNNNNNTAC 2 cut(s) 171, 203
BccI CCATC 1 cut(s) 44
BfaI CTAG 1 cut(s) 176
BmgBI CACGTC 1 cut(s) 210
BmsI GCATC 1 cut(s) 98
BsaXI ACNNNNNCTCC 2 cut(s) 100, 130
BseGI GGATG 2 cut(s) 89, 161
BspACI CCGC 2 cut(s) 87, 195
Bst6I CTCTTC 1 cut(s) 140
BstC8I GCNNGC 1 cut(s) 199
BstF5I GGATG 2 cut(s) 89, 161
BstMWI GCNNNNNNNGC 1 cut(s) 146
BtrI CACGTC 1 cut(s) 210
BtsCI GGATG 2 cut(s) 89, 161
Cac8I GCNNGC 1 cut(s) 199
CviAII CATG 1 cut(s) 128
CviJI RGCY 1 cut(s) 182
CviKI_1 RGCY 1 cut(s) 182
Eam1104I CTCTTC 1 cut(s) 140
EarI CTCTTC 1 cut(s) 140
FaeI CATG 1 cut(s) 131
FaiI YATR 1 cut(s) 129
FatI CATG 1 cut(s) 127
FauI CCCGC 1 cut(s) 94
FokI GGATG 2 cut(s) 76, 148
FspBI CTAG 1 cut(s) 176
Hin1II CATG 1 cut(s) 131
Hpy188III TCNNGA 1 cut(s) 176
HpyAV CCTTC 1 cut(s) 168
HpyCH4IV ACGT 1 cut(s) 209
HpyCH4V TGCA 2 cut(s) 17, 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpySE526I ACGT 1 cut(s) 209
Hsp92II CATG 1 cut(s) 131
LpnPI CCDG 1 cut(s) 107
LweI GCATC 1 cut(s) 98
MaeI CTAG 1 cut(s) 176
MaeII ACGT 1 cut(s) 209
MaeIII GTNAC 1 cut(s) 210
MboII GAAGA 1 cut(s) 127
MluCI AATT 1 cut(s) 40
MnlI CCTC 3 cut(s) 69, 143, 175
MseI TTAA 1 cut(s) 144
MwoI GCNNNNNNNGC 1 cut(s) 146
NlaIII CATG 1 cut(s) 131
NmuCI GTSAC 1 cut(s) 210
SaqAI TTAA 1 cut(s) 144
SetI ASST 4 cut(s) 61, 135, 160, 212
SfaNI GCATC 1 cut(s) 98
SgeI CNNG 7 cut(s) 98, 106, 132, 140, 188, 210, 220
Sse9I AATT 1 cut(s) 40
SsiI CCGC 2 cut(s) 87, 195
SspMI CTAG 1 cut(s) 176
TaiI ACGT 1 cut(s) 212
TasI AATT 1 cut(s) 40
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
TseFI GTSAC 1 cut(s) 210
Tsp45I GTSAC 1 cut(s) 210
TspDTI ATGAA 1 cut(s) 150
XbaI TCTAGA 1 cut(s) 175
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.