pycom14g01040

Polysaccharide biosynthesis

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Reverse (-)
739175 .. 739540
366 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g01040.2

Sequence Viewer

Length: 282 bp
ATGAACACCAACACCACCATTCACCAAACCCTCCCCACCTCCTCCCTCACCCCCACCTTCGTACTCCCCCTCCCGCCCGCCGTCCTGGACCCACTTCTTCACTACACCATTTCATTATCAAACACCTCGTCAGCATCCCACATGTCCCCGCCGAAACTCACCTCCATATCCTCCGCCCTCACCCACCTCTGCGCACCCAACTGCAATTTCCTCATTTTCGGCCTCACCAGTCCAGAACCTGATAGAAAAAAAAAATTAAAAAAGGCGTCTAACATCAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.0

Weight (kDa)

9.45

Isoelectric Point (pI)

49.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013606)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 193
AciI CCGC 4 cut(s) 74, 78, 149, 174
AcyI GRCGYC 1 cut(s) 266
AfaI GTAC 1 cut(s) 63
AflIII ACRYGT 1 cut(s) 141
AjnI CCWGG 1 cut(s) 84
AjuI GAANNNNNNNTTGG 2 cut(s) 191, 223
AluBI AGCT 1 cut(s) 279
AluI AGCT 1 cut(s) 279
AlwNI CAGNNNCTG 1 cut(s) 239
AoxI GGCC 1 cut(s) 220
ArsI GACNNNNNNTTYG 2 cut(s) 113, 145
AspLEI GCGC 1 cut(s) 194
AspS9I GGNCC 1 cut(s) 88
AsuHPI GGTGA 5 cut(s) 14, 40, 151, 172, 217
AvaII GGWCC 1 cut(s) 88
BceAI ACGGC 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 86
Bme1390I CCNGG 1 cut(s) 86
Bme18I GGWCC 1 cut(s) 88
BmgT120I GGNCC 1 cut(s) 88
BmiI GGNNCC 1 cut(s) 90
BmrFI CCNGG 1 cut(s) 86
BmsI GCATC 1 cut(s) 143
BsaHI GRCGYC 1 cut(s) 266
BsaXI ACNNNNNCTCC 2 cut(s) 54, 84
Bse1I ACTGG 1 cut(s) 228
BseBI CCWGG 1 cut(s) 86
BseGI GGATG 1 cut(s) 134
BseNI ACTGG 1 cut(s) 228
BseRI GAGGAG 1 cut(s) 31
BshFI GGCC 1 cut(s) 222
BslFI GGGAC 1 cut(s) 130
BsmFI GGGAC 1 cut(s) 130
BsnI GGCC 1 cut(s) 222
BspACI CCGC 4 cut(s) 74, 78, 149, 174
BspANI GGCC 1 cut(s) 222
BspLI GGNNCC 1 cut(s) 90
BsrI ACTGG 1 cut(s) 228
BssNI GRCGYC 1 cut(s) 266
Bst2UI CCWGG 1 cut(s) 86
BstACI GRCGYC 1 cut(s) 266
BstC8I GCNNGC 1 cut(s) 78
BstF5I GGATG 1 cut(s) 134
BstHHI GCGC 1 cut(s) 194
BstNI CCWGG 1 cut(s) 86
BstNSI RCATGY 1 cut(s) 145
BstSCI CCNGG 1 cut(s) 84
BsuRI GGCC 1 cut(s) 222
BtsCI GGATG 1 cut(s) 134
Cac8I GCNNGC 1 cut(s) 78
CaiI CAGNNNCTG 1 cut(s) 239
CfoI GCGC 1 cut(s) 194
Cfr13I GGNCC 1 cut(s) 88
CseI GACGC 1 cut(s) 255
Csp6I GTAC 1 cut(s) 62
CviAII CATG 1 cut(s) 142
CviJI RGCY 2 cut(s) 222, 279
CviKI_1 RGCY 2 cut(s) 222, 279
CviQI GTAC 1 cut(s) 62
EciI GGCGGA 1 cut(s) 163
Eco47I GGWCC 1 cut(s) 88
EcoRII CCWGG 1 cut(s) 84
FaeI CATG 1 cut(s) 145
FaiI YATR 2 cut(s) 143, 167
FaqI GGGAC 1 cut(s) 130
FatI CATG 1 cut(s) 141
FauI CCCGC 3 cut(s) 81, 85, 156
FokI GGATG 1 cut(s) 121
FspI TGCGCA 1 cut(s) 193
GlaI GCGC 1 cut(s) 193
HaeIII GGCC 1 cut(s) 222
HgaI GACGC 1 cut(s) 255
HhaI GCGC 1 cut(s) 194
Hin1I GRCGYC 1 cut(s) 266
Hin1II CATG 1 cut(s) 145
Hin6I GCGC 1 cut(s) 192
HinP1I GCGC 1 cut(s) 192
HphI GGTGA 5 cut(s) 14, 40, 151, 172, 217
Hpy188III TCNNGA 1 cut(s) 233
HpyAV CCTTC 1 cut(s) 67
HpyCH4V TGCA 1 cut(s) 204
Hsp92I GRCGYC 1 cut(s) 266
Hsp92II CATG 1 cut(s) 145
HspAI GCGC 1 cut(s) 192
LpnPI CCDG 5 cut(s) 71, 98, 241, 246, 252
LweI GCATC 1 cut(s) 143
MboII GAAGA 1 cut(s) 89
MluCI AATT 2 cut(s) 205, 254
MseI TTAA 1 cut(s) 257
MspR9I CCNGG 1 cut(s) 86
MvaI CCWGG 1 cut(s) 86
NlaIII CATG 1 cut(s) 145
NlaIV GGNNCC 1 cut(s) 90
NsbI TGCGCA 1 cut(s) 193
NspI RCATGY 1 cut(s) 145
PciI ACATGT 1 cut(s) 141
PfoI TCCNGGA 1 cut(s) 84
PscI ACATGT 1 cut(s) 141
Psp6I CCWGG 1 cut(s) 84
PspGI CCWGG 1 cut(s) 84
PspN4I GGNNCC 1 cut(s) 90
PspPI GGNCC 1 cut(s) 88
PstNI CAGNNNCTG 1 cut(s) 239
RsaI GTAC 1 cut(s) 63
RsaNI GTAC 1 cut(s) 62
SaqAI TTAA 1 cut(s) 257
Sau96I GGNCC 1 cut(s) 88
ScrFI CCNGG 1 cut(s) 86
SetI ASST 7 cut(s) 41, 59, 128, 164, 189, 241, 281
SfaNI GCATC 1 cut(s) 143
SinI GGWCC 1 cut(s) 88
Sse9I AATT 2 cut(s) 205, 254
SsiI CCGC 4 cut(s) 74, 78, 149, 174
StyD4I CCNGG 1 cut(s) 84
TasI AATT 2 cut(s) 205, 254
Tru1I TTAA 1 cut(s) 257
Tru9I TTAA 1 cut(s) 257
TspDTI ATGAA 2 cut(s) 17, 102
VpaK11BI GGWCC 1 cut(s) 88
XceI RCATGY 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.