pycom14g14460

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
OG0002152
Physical Location & Seq
Forward (+)
17229581 .. 17229999
419 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g14460.1

Sequence Viewer

Length: 267 bp
ATGGTGATAGGATTGTCGAAGTTATTGTTTCTGCTTCCGATGATGAATGGTTCTTCAGCAAACCTGGTGGTCATTGCAATATCAGTGTTGCTTCTTATGGGGGAATGCCGAGCAACTTGTGGACTACTTCCTCATGACGGTTGCTTTGAATGTCAAAATGATATTTTGAGCAAGAAAGTAATGCATGTTTGCCGCAGCCTTAGATCCAATCCGTGGAGGCCACCACCTGCACCTACTAAAGCTACTACACCAATACATGACCGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

9.63

Weight (kDa)

9.04

Isoelectric Point (pI)

51.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 235
Acc36I ACCTGC 1 cut(s) 235
AccB7I CCANNNNNTGG 1 cut(s) 213
AciI CCGC 2 cut(s) 193, 262
AclWI GGATC 1 cut(s) 198
AcuI CTGAAG 1 cut(s) 39
AfiI CCNNNNNNNGG 2 cut(s) 137, 213
AgsI TTSAA 1 cut(s) 149
AjnI CCWGG 1 cut(s) 63
AluBI AGCT 1 cut(s) 242
AluI AGCT 1 cut(s) 242
AlwI GGATC 1 cut(s) 198
AoxI GGCC 1 cut(s) 218
ApeKI GCWGC 1 cut(s) 195
ArsI GACNNNNNNTTYG 2 cut(s) 128, 160
AsuHPI GGTGA 1 cut(s) 16
BbvI GCAGC 1 cut(s) 207
BciT130I CCWGG 1 cut(s) 65
BfuAI ACCTGC 1 cut(s) 235
BisI GCNGC 2 cut(s) 193, 196
BlsI GCNGC 2 cut(s) 194, 197
Bme1390I CCNGG 1 cut(s) 65
BmrFI CCNGG 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 212
Bsc4I CCNNNNNNNGG 2 cut(s) 137, 213
Bse3DI GCAATG 1 cut(s) 72
BseBI CCWGG 1 cut(s) 65
BseDI CCNNGG 1 cut(s) 212
BseLI CCNNNNNNNGG 2 cut(s) 137, 213
BseMI GCAATG 1 cut(s) 72
BseXI GCAGC 1 cut(s) 207
BsgI GTGCAG 1 cut(s) 213
BshFI GGCC 1 cut(s) 220
BslI CCNNNNNNNGG 2 cut(s) 137, 213
BsmI GAATGC 1 cut(s) 110
BsnI GGCC 1 cut(s) 220
Bsp143I GATC 1 cut(s) 203
BspACI CCGC 2 cut(s) 193, 262
BspANI GGCC 1 cut(s) 220
BspHI TCATGA 1 cut(s) 133
BspMI ACCTGC 1 cut(s) 235
BspPI GGATC 1 cut(s) 198
BsrDI GCAATG 1 cut(s) 72
BssECI CCNNGG 1 cut(s) 212
BssMI GATC 1 cut(s) 203
Bst2UI CCWGG 1 cut(s) 65
Bst4CI ACNGT 1 cut(s) 140
BstDEI CTNAG 1 cut(s) 200
BstDSI CCRYGG 1 cut(s) 212
BstKTI GATC 1 cut(s) 206
BstMBI GATC 1 cut(s) 203
BstNI CCWGG 1 cut(s) 65
BstNSI RCATGY 1 cut(s) 188
BstSCI CCNGG 1 cut(s) 63
BstV1I GCAGC 1 cut(s) 207
BstX2I RGATCY 1 cut(s) 203
BstYI RGATCY 1 cut(s) 203
BsuRI GGCC 1 cut(s) 220
BtgI CCRYGG 1 cut(s) 212
BtsIMutI CAGTG 1 cut(s) 90
BveI ACCTGC 1 cut(s) 235
CciI TCATGA 1 cut(s) 133
CsiI ACCWGGT 1 cut(s) 63
CspCI CAANNNNNGTGG 2 cut(s) 48, 83
CviAII CATG 3 cut(s) 134, 185, 257
CviJI RGCY 3 cut(s) 198, 220, 242
CviKI_1 RGCY 3 cut(s) 198, 220, 242
DdeI CTNAG 1 cut(s) 200
DpnI GATC 1 cut(s) 205
DpnII GATC 1 cut(s) 203
Eco57I CTGAAG 1 cut(s) 39
EcoRII CCWGG 1 cut(s) 63
EcoT22I ATGCAT 1 cut(s) 186
FaeI CATG 3 cut(s) 137, 188, 260
FaiI YATR 4 cut(s) 98, 135, 186, 258
FatI CATG 3 cut(s) 133, 184, 256
Fnu4HI GCNGC 2 cut(s) 193, 196
Fsp4HI GCNGC 2 cut(s) 193, 196
GluI GCNGC 2 cut(s) 193, 196
HaeIII GGCC 1 cut(s) 220
Hin1II CATG 3 cut(s) 137, 188, 260
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 122
Hpy188I TCNGA 1 cut(s) 39
Hpy188III TCNNGA 1 cut(s) 134
Hpy8I GTNNAC 1 cut(s) 122
HpyCH4III ACNGT 1 cut(s) 140
HpyCH4V TGCA 3 cut(s) 77, 184, 230
HpyF3I CTNAG 1 cut(s) 200
Hsp92II CATG 3 cut(s) 137, 188, 260
Kzo9I GATC 1 cut(s) 203
LpnPI CCDG 3 cut(s) 50, 77, 240
Lsp1109I GCAGC 1 cut(s) 207
MabI ACCWGGT 1 cut(s) 63
MalI GATC 1 cut(s) 205
MboI GATC 1 cut(s) 203
MboII GAAGA 1 cut(s) 45
MflI RGATCY 1 cut(s) 203
MnlI CCTC 2 cut(s) 141, 210
Mph1103I ATGCAT 1 cut(s) 186
MspR9I CCNGG 1 cut(s) 65
Mva1269I GAATGC 1 cut(s) 110
MvaI CCWGG 1 cut(s) 65
NdeII GATC 1 cut(s) 203
NlaIII CATG 3 cut(s) 137, 188, 260
NmeAIII GCCGAG 1 cut(s) 134
NsiI ATGCAT 1 cut(s) 186
NspI RCATGY 1 cut(s) 188
PagI TCATGA 1 cut(s) 133
PaqCI CACCTGC 1 cut(s) 235
PctI GAATGC 1 cut(s) 110
PflMI CCANNNNNTGG 1 cut(s) 213
PkrI GCNGC 2 cut(s) 194, 197
Psp6I CCWGG 1 cut(s) 63
PspGI CCWGG 1 cut(s) 63
PsuI RGATCY 1 cut(s) 203
SatI GCNGC 2 cut(s) 193, 196
Sau3AI GATC 1 cut(s) 203
ScrFI CCNGG 1 cut(s) 65
SetI ASST 4 cut(s) 66, 229, 235, 244
SexAI ACCWGGT 1 cut(s) 63
SgeI CNNG 9 cut(s) 76, 77, 122, 129, 146, 184, 197, 225, 239
SsiI CCGC 2 cut(s) 193, 262
StyD4I CCNGG 1 cut(s) 63
TaaI ACNGT 1 cut(s) 140
TaqI TCGA 1 cut(s) 17
TauI GCSGC 1 cut(s) 195
TscAI CASTG 1 cut(s) 90
TseI GCWGC 1 cut(s) 195
TspDTI ATGAA 1 cut(s) 59
TspGWI ACGGA 1 cut(s) 201
TspRI CASTG 1 cut(s) 90
Van91I CCANNNNNTGG 1 cut(s) 213
XceI RCATGY 1 cut(s) 188
Zsp2I ATGCAT 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.