pycom17g09620

ADP-ribosylation factor GTPase-activating protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
7314759 .. 7316064
1306 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGGTTTCCCTCAGGGTTTGGGAACCTATACCTGTGGACTTATTTCGCAACTTGGGTAATGCATATTGCAATTCTGTATGGGAGGGAACGCTTCTACTTGAGAATGAAAAACTGGATGGCTGGAAGGACATGAGGGCTCCAGTTTTCAAACCAGGCCCCAAGGATGAAGCTCAGCATAAGGAAATATACATTCAAGCAAAGGTAATCCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling

Protein Analysis

71

Amino Acids

8.14

Weight (kDa)

6.05

Isoelectric Point (pI)

23.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 148, 194
AjnI CCWGG 1 cut(s) 151
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
AoxI GGCC 1 cut(s) 154
AspS9I GGNCC 1 cut(s) 155
AxyI CCTNAGG 1 cut(s) 11
BanII GRGCYC 1 cut(s) 139
BccI CCATC 1 cut(s) 110
BciT130I CCWGG 1 cut(s) 153
BlpI GCTNAGC 1 cut(s) 171
Bme1390I CCNGG 1 cut(s) 153
BmgT120I GGNCC 1 cut(s) 155
BmiI GGNNCC 3 cut(s) 24, 138, 157
BmrFI CCNGG 1 cut(s) 153
BpmI CTGGAG 1 cut(s) 123
Bpu1102I GCTNAGC 1 cut(s) 171
BpuEI CTTGAG 1 cut(s) 119
BsaJI CCNNGG 1 cut(s) 159
Bse1I ACTGG 2 cut(s) 117, 140
Bse21I CCTNAGG 1 cut(s) 11
BseBI CCWGG 1 cut(s) 153
BseDI CCNNGG 1 cut(s) 159
BseGI GGATG 2 cut(s) 121, 169
BseMII CTCAG 2 cut(s) 25, 185
BseNI ACTGG 2 cut(s) 117, 140
BshFI GGCC 1 cut(s) 156
BsnI GGCC 1 cut(s) 156
Bsp1286I GDGCHC 1 cut(s) 139
Bsp1720I GCTNAGC 1 cut(s) 171
BspANI GGCC 1 cut(s) 156
BspCNI CTCAG 2 cut(s) 24, 184
BspLI GGNNCC 3 cut(s) 24, 138, 157
BsrI ACTGG 2 cut(s) 117, 140
BssECI CCNNGG 1 cut(s) 159
BssT1I CCWWGG 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 153
BstDEI CTNAG 2 cut(s) 11, 171
BstF5I GGATG 2 cut(s) 121, 169
BstNI CCWGG 1 cut(s) 153
BstSCI CCNGG 1 cut(s) 151
Bsu36I CCTNAGG 1 cut(s) 11
BsuRI GGCC 1 cut(s) 156
BtsCI GGATG 2 cut(s) 121, 169
Cfr13I GGNCC 1 cut(s) 155
CviAII CATG 1 cut(s) 130
CviJI RGCY 4 cut(s) 120, 137, 156, 170
CviKI_1 RGCY 4 cut(s) 120, 137, 156, 170
DdeI CTNAG 2 cut(s) 11, 171
Eco130I CCWWGG 1 cut(s) 159
Eco24I GRGCYC 1 cut(s) 139
Eco81I CCTNAGG 1 cut(s) 11
EcoO109I RGGNCCY 1 cut(s) 155
EcoRII CCWGG 1 cut(s) 151
EcoT14I CCWWGG 1 cut(s) 159
EcoT22I ATGCAT 1 cut(s) 64
EcoT38I GRGCYC 1 cut(s) 139
ErhI CCWWGG 1 cut(s) 159
FaeI CATG 1 cut(s) 133
FaiI YATR 6 cut(s) 29, 64, 79, 131, 177, 187
FatI CATG 1 cut(s) 129
FokI GGATG 2 cut(s) 128, 176
FriOI GRGCYC 1 cut(s) 139
GsuI CTGGAG 1 cut(s) 123
HaeIII GGCC 1 cut(s) 156
Hin1II CATG 1 cut(s) 133
Hpy166II GTNNAC 1 cut(s) 37
Hpy8I GTNNAC 1 cut(s) 37
HpyAV CCTTC 1 cut(s) 118
HpyCH4V TGCA 2 cut(s) 62, 69
HpyF3I CTNAG 2 cut(s) 11, 171
Hsp92II CATG 1 cut(s) 133
LmnI GCTCC 1 cut(s) 142
LpnPI CCDG 6 cut(s) 45, 98, 106, 138, 153, 165
MhlI GDGCHC 1 cut(s) 139
MluCI AATT 1 cut(s) 70
MnlI CCTC 3 cut(s) 20, 76, 126
Mph1103I ATGCAT 1 cut(s) 64
MseI TTAA 1 cut(s) 211
MspR9I CCNGG 1 cut(s) 153
MvaI CCWGG 1 cut(s) 153
NlaIII CATG 1 cut(s) 133
NlaIV GGNNCC 3 cut(s) 24, 138, 157
NsiI ATGCAT 1 cut(s) 64
Psp6I CCWGG 1 cut(s) 151
PspGI CCWGG 1 cut(s) 151
PspN4I GGNNCC 3 cut(s) 24, 138, 157
PspPI GGNCC 1 cut(s) 155
SaqAI TTAA 1 cut(s) 211
Sau96I GGNCC 1 cut(s) 155
ScrFI CCNGG 1 cut(s) 153
SduI GDGCHC 1 cut(s) 139
SetI ASST 4 cut(s) 28, 34, 172, 204
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 1 cut(s) 70
StyD4I CCNGG 1 cut(s) 151
StyI CCWWGG 1 cut(s) 159
TasI AATT 1 cut(s) 70
Tru1I TTAA 1 cut(s) 211
Tru9I TTAA 1 cut(s) 211
TspDTI ATGAA 2 cut(s) 120, 180
Zsp2I ATGCAT 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.