RchiOBHm_Chr5g0010131

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
6745812 .. 6750625
4814 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 294 bp
ATGGCTTCATTCTGCAGATCAGCACTTACAGCTGGCTCAAGGTGCATCTCAGCTCGCTCCAGATCCCTCAACCACAGCTCACTAAATGCTATAAGCCCTAAAGTCTTGTCGTCTCCTTTTGCTTCATCGACTAAAGCAAATTCTAGCTCTACCAGGTTCATTTCAGTTCTTGGAAGCGCGGAGTCAATGATGCCATTTCACAGTGCCATTGCTTCTCCTCGGCTCAACTCCACAGTTGCCTTTGATTTCACCTGCTGGAGTTGCCTTTCTCAAGGACTTCTTGATACTAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.2

Weight (kDa)

9.69

Isoelectric Point (pI)

69.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 260
Acc36I ACCTGC 1 cut(s) 260
AccII CGCG 1 cut(s) 179
AciI CCGC 1 cut(s) 179
AclWI GGATC 1 cut(s) 57
AcsI RAATTY 1 cut(s) 139
AjnI CCWGG 1 cut(s) 152
AluBI AGCT 5 cut(s) 32, 53, 78, 147, 291
AluI AGCT 5 cut(s) 32, 53, 78, 147, 291
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 1 cut(s) 57
ApoI RAATTY 1 cut(s) 139
AspLEI GCGC 1 cut(s) 179
AsuHPI GGTGA 1 cut(s) 241
BciT130I CCWGG 1 cut(s) 154
BcoDI GTCTC 1 cut(s) 117
BfaI CTAG 2 cut(s) 144, 288
BfmI CTRYAG 1 cut(s) 13
BfuAI ACCTGC 1 cut(s) 260
Bme1390I CCNGG 1 cut(s) 154
BmrFI CCNGG 1 cut(s) 154
BmsI GCATC 2 cut(s) 54, 180
BpmI CTGGAG 2 cut(s) 43, 277
BpuEI CTTGAG 2 cut(s) 22, 255
BsaJI CCNNGG 1 cut(s) 218
Bse3DI GCAATG 1 cut(s) 207
BseBI CCWGG 1 cut(s) 154
BseDI CCNNGG 1 cut(s) 218
BseMI GCAATG 1 cut(s) 207
BseMII CTCAG 1 cut(s) 63
BseRI GAGGAG 1 cut(s) 207
Bsh1236I CGCG 1 cut(s) 179
BsmAI GTCTC 1 cut(s) 117
BsmBI CGTCTC 1 cut(s) 117
Bsp143I GATC 2 cut(s) 17, 62
BspACI CCGC 1 cut(s) 179
BspCNI CTCAG 1 cut(s) 62
BspFNI CGCG 1 cut(s) 179
BspMAI CTGCAG 1 cut(s) 17
BspMI ACCTGC 1 cut(s) 260
BspPI GGATC 1 cut(s) 57
BsrDI GCAATG 1 cut(s) 207
BssECI CCNNGG 1 cut(s) 218
BssMI GATC 2 cut(s) 17, 62
Bst2UI CCWGG 1 cut(s) 154
Bst4CI ACNGT 2 cut(s) 203, 235
BstC8I GCNNGC 2 cut(s) 34, 55
BstDEI CTNAG 1 cut(s) 49
BstFNI CGCG 1 cut(s) 179
BstHHI GCGC 1 cut(s) 179
BstKTI GATC 2 cut(s) 20, 65
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 2 cut(s) 17, 62
BstMWI GCNNNNNNNGC 3 cut(s) 29, 42, 261
BstNI CCWGG 1 cut(s) 154
BstSCI CCNGG 1 cut(s) 152
BstSFI CTRYAG 1 cut(s) 13
BstUI CGCG 1 cut(s) 179
BstX2I RGATCY 1 cut(s) 62
BstYI RGATCY 1 cut(s) 62
BtsIMutI CAGTG 1 cut(s) 208
BveI ACCTGC 1 cut(s) 260
Cac8I GCNNGC 2 cut(s) 34, 55
CfoI GCGC 1 cut(s) 179
CsiI ACCWGGT 1 cut(s) 152
CviJI RGCY 9 cut(s) 5, 32, 36, 53, 78, 96, 147, 223, 291
CviKI_1 RGCY 9 cut(s) 5, 32, 36, 53, 78, 96, 147, 223, 291
DdeI CTNAG 1 cut(s) 49
DpnI GATC 2 cut(s) 19, 64
DpnII GATC 2 cut(s) 17, 62
EcoRII CCWGG 1 cut(s) 152
Esp3I CGTCTC 1 cut(s) 117
FaiI YATR 1 cut(s) 92
FalI AAGNNNNNCTT 1 cut(s) 264
FspBI CTAG 2 cut(s) 144, 288
GlaI GCGC 1 cut(s) 178
GsuI CTGGAG 2 cut(s) 43, 277
HhaI GCGC 1 cut(s) 179
Hin6I GCGC 1 cut(s) 177
HinP1I GCGC 1 cut(s) 177
HinfI GANTC 1 cut(s) 182
HphI GGTGA 1 cut(s) 241
Hpy188III TCNNGA 2 cut(s) 60, 281
HpyCH4III ACNGT 2 cut(s) 203, 235
HpyCH4V TGCA 2 cut(s) 15, 45
HpyF10VI GCNNNNNNNGC 3 cut(s) 29, 42, 261
HpyF3I CTNAG 1 cut(s) 49
HspAI GCGC 1 cut(s) 177
Kzo9I GATC 2 cut(s) 17, 62
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 6 cut(s) 18, 73, 139, 166, 241, 265
LweI GCATC 2 cut(s) 54, 180
MabI ACCWGGT 1 cut(s) 152
MaeI CTAG 2 cut(s) 144, 288
MalI GATC 2 cut(s) 19, 64
MboI GATC 2 cut(s) 17, 62
MflI RGATCY 1 cut(s) 62
MluCI AATT 1 cut(s) 139
MlyI GAGTC 1 cut(s) 191
MnlI CCTC 2 cut(s) 77, 228
MspA1I CMGCKG 1 cut(s) 32
MspR9I CCNGG 1 cut(s) 154
MvaI CCWGG 1 cut(s) 154
MvnI CGCG 1 cut(s) 179
MwoI GCNNNNNNNGC 3 cut(s) 29, 42, 261
NdeII GATC 2 cut(s) 17, 62
NmeAIII GCCGAG 1 cut(s) 199
PaqCI CACCTGC 1 cut(s) 260
PleI GAGTC 1 cut(s) 190
PpsI GAGTC 1 cut(s) 190
Psp6I CCWGG 1 cut(s) 152
PspGI CCWGG 1 cut(s) 152
PstI CTGCAG 1 cut(s) 17
PsuI RGATCY 1 cut(s) 62
PvuII CAGCTG 1 cut(s) 32
Sau3AI GATC 2 cut(s) 17, 62
SchI GAGTC 1 cut(s) 191
ScrFI CCNGG 1 cut(s) 154
SetI ASST 8 cut(s) 34, 44, 55, 80, 149, 158, 254, 293
SexAI ACCWGGT 1 cut(s) 152
SfaNI GCATC 2 cut(s) 54, 180
SfcI CTRYAG 1 cut(s) 13
SmlI CTYRAG 2 cut(s) 37, 270
SmoI CTYRAG 2 cut(s) 37, 270
Sse9I AATT 1 cut(s) 139
SsiI CCGC 1 cut(s) 179
SspMI CTAG 2 cut(s) 144, 288
StyD4I CCNGG 1 cut(s) 152
TaaI ACNGT 2 cut(s) 203, 235
TaqI TCGA 1 cut(s) 128
TasI AATT 1 cut(s) 139
TscAI CASTG 1 cut(s) 208
TspDTI ATGAA 2 cut(s) 114, 148
TspRI CASTG 1 cut(s) 208
XapI RAATTY 1 cut(s) 139
XspI CTAG 2 cut(s) 144, 288
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.