Rroxscaffold_1G00066060

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
87590628 .. 87590921
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00066060.1

Sequence Viewer

Length: 294 bp
ATGGCTTCATTCTGCAGATCAGTGCTTATAGCTGGCTCAAGGTGCATCTCAGCTCGCTCCAGATCCTTCAACCACAGCTCACTAAATGCTATAAGCCCTAAAGTCTTGTCGTCTCCTTTTGCTTCATCGACTAAAGCAAACCCTAGCTCTACTAGGTTCATTTCAGTTCTTGGAAGCGTGGAGTCAATGATGCCATTTCACAGTGCCATTGCTTCTCCTCGGCTCAACTCCACAATTGCCTTTGATTTCACCTGCTGGAGTTCCCTTTCTCAAGGACTTCTTGATACTAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.31

Weight (kDa)

10.12

Isoelectric Point (pI)

65.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 260
Acc36I ACCTGC 1 cut(s) 260
AclWI GGATC 1 cut(s) 57
AgsI TTSAA 1 cut(s) 70
AluBI AGCT 5 cut(s) 32, 53, 78, 147, 291
AluI AGCT 5 cut(s) 32, 53, 78, 147, 291
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 1 cut(s) 57
AsuHPI GGTGA 1 cut(s) 241
BcoDI GTCTC 1 cut(s) 117
BfaI CTAG 3 cut(s) 144, 153, 288
BfmI CTRYAG 1 cut(s) 13
BfuAI ACCTGC 1 cut(s) 260
BmsI GCATC 2 cut(s) 54, 180
BpmI CTGGAG 2 cut(s) 43, 277
BpuEI CTTGAG 2 cut(s) 22, 255
BsaJI CCNNGG 1 cut(s) 218
Bse3DI GCAATG 1 cut(s) 207
BseDI CCNNGG 1 cut(s) 218
BseMI GCAATG 1 cut(s) 207
BseMII CTCAG 1 cut(s) 63
BseRI GAGGAG 1 cut(s) 207
BsmAI GTCTC 1 cut(s) 117
BsmBI CGTCTC 1 cut(s) 117
Bsp143I GATC 2 cut(s) 17, 62
BspCNI CTCAG 1 cut(s) 62
BspMAI CTGCAG 1 cut(s) 17
BspMI ACCTGC 1 cut(s) 260
BspPI GGATC 1 cut(s) 57
BsrDI GCAATG 1 cut(s) 207
BssECI CCNNGG 1 cut(s) 218
BssMI GATC 2 cut(s) 17, 62
Bst4CI ACNGT 1 cut(s) 203
BstC8I GCNNGC 2 cut(s) 34, 55
BstDEI CTNAG 1 cut(s) 49
BstKTI GATC 2 cut(s) 20, 65
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 2 cut(s) 17, 62
BstMWI GCNNNNNNNGC 1 cut(s) 42
BstSFI CTRYAG 1 cut(s) 13
BstX2I RGATCY 1 cut(s) 62
BstYI RGATCY 1 cut(s) 62
BtsIMutI CAGTG 2 cut(s) 27, 208
BveI ACCTGC 1 cut(s) 260
Cac8I GCNNGC 2 cut(s) 34, 55
CviJI RGCY 9 cut(s) 5, 32, 36, 53, 78, 96, 147, 223, 291
CviKI_1 RGCY 9 cut(s) 5, 32, 36, 53, 78, 96, 147, 223, 291
DdeI CTNAG 1 cut(s) 49
DpnI GATC 2 cut(s) 19, 64
DpnII GATC 2 cut(s) 17, 62
Esp3I CGTCTC 1 cut(s) 117
FaiI YATR 2 cut(s) 29, 92
FalI AAGNNNNNCTT 1 cut(s) 264
FspBI CTAG 3 cut(s) 144, 153, 288
GsuI CTGGAG 2 cut(s) 43, 277
HinfI GANTC 1 cut(s) 182
HphI GGTGA 1 cut(s) 241
Hpy188III TCNNGA 2 cut(s) 60, 281
HpyAV CCTTC 1 cut(s) 76
HpyCH4III ACNGT 1 cut(s) 203
HpyCH4V TGCA 2 cut(s) 15, 45
HpyF10VI GCNNNNNNNGC 1 cut(s) 42
HpyF3I CTNAG 1 cut(s) 49
Kzo9I GATC 2 cut(s) 17, 62
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 4 cut(s) 18, 73, 241, 265
LweI GCATC 2 cut(s) 54, 180
MaeI CTAG 3 cut(s) 144, 153, 288
MalI GATC 2 cut(s) 19, 64
MboI GATC 2 cut(s) 17, 62
MfeI CAATTG 1 cut(s) 234
MflI RGATCY 1 cut(s) 62
MluCI AATT 1 cut(s) 234
MlyI GAGTC 1 cut(s) 191
MnlI CCTC 1 cut(s) 228
MunI CAATTG 1 cut(s) 234
MwoI GCNNNNNNNGC 1 cut(s) 42
NdeII GATC 2 cut(s) 17, 62
NmeAIII GCCGAG 1 cut(s) 199
PaqCI CACCTGC 1 cut(s) 260
PleI GAGTC 1 cut(s) 190
PpsI GAGTC 1 cut(s) 190
PstI CTGCAG 1 cut(s) 17
PsuI RGATCY 1 cut(s) 62
Sau3AI GATC 2 cut(s) 17, 62
SchI GAGTC 1 cut(s) 191
SetI ASST 8 cut(s) 34, 44, 55, 80, 149, 158, 254, 293
SfaNI GCATC 2 cut(s) 54, 180
SfcI CTRYAG 1 cut(s) 13
SmlI CTYRAG 2 cut(s) 37, 270
SmoI CTYRAG 2 cut(s) 37, 270
Sse9I AATT 1 cut(s) 234
SspMI CTAG 3 cut(s) 144, 153, 288
TaaI ACNGT 1 cut(s) 203
TaqI TCGA 1 cut(s) 128
TasI AATT 1 cut(s) 234
TscAI CASTG 2 cut(s) 27, 208
TspDTI ATGAA 2 cut(s) 114, 148
TspRI CASTG 2 cut(s) 27, 208
XspI CTAG 3 cut(s) 144, 153, 288
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.