Rmu_sc0000818.1_g000003

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000818.1
Physical Location & Seq
Reverse (-)
20683 .. 21525
843 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000818.1_g000003.1.cds

Sequence Viewer

Length: 372 bp
atgaaatgcaggaatcaggaagttaaaagttggaagtgggcacttcaattcaggacacttatctccccagcacaagaaatggcttcattctgcagatcagcgcttatagctggctcaaggtgcatctcagctcgctccagatccctcaaccacagctcactaaatgctataagccctaaagtcttgtcgtctccttttgcttcatcgactaaagcaaaccctagctctactaggttcatttcagttcttggaagcgtggagccaatgatgccatttcacagtgccattgcttctcctcggctcaactccacaattgcctttgatttcacctgctggagttgcctttctcaaggacttcttgatactagctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

123

Amino Acids

13.43

Weight (kDa)

9.97

Isoelectric Point (pI)

65.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 338
Acc36I ACCTGC 1 cut(s) 338
AclWI GGATC 1 cut(s) 135
AfeI AGCGCT 1 cut(s) 102
AgsI TTSAA 1 cut(s) 47
AluBI AGCT 5 cut(s) 110, 131, 156, 225, 369
AluI AGCT 5 cut(s) 110, 131, 156, 225, 369
Alw26I GTCTC 1 cut(s) 195
AlwI GGATC 1 cut(s) 135
Aor51HI AGCGCT 1 cut(s) 102
AspLEI GCGC 1 cut(s) 103
AsuHPI GGTGA 1 cut(s) 319
BaeGI GKGCMC 1 cut(s) 43
BcoDI GTCTC 1 cut(s) 195
BfaI CTAG 3 cut(s) 222, 231, 366
BfmI CTRYAG 1 cut(s) 91
BfoI RGCGCY 1 cut(s) 104
BfuAI ACCTGC 1 cut(s) 338
BmiI GGNNCC 1 cut(s) 261
BmsI GCATC 2 cut(s) 132, 258
BpmI CTGGAG 2 cut(s) 121, 355
BpuEI CTTGAG 2 cut(s) 100, 333
BsaJI CCNNGG 1 cut(s) 296
Bse3DI GCAATG 1 cut(s) 285
BseDI CCNNGG 1 cut(s) 296
BseMI GCAATG 1 cut(s) 285
BseMII CTCAG 1 cut(s) 141
BseRI GAGGAG 1 cut(s) 285
BseSI GKGCMC 1 cut(s) 43
BseYI CCCAGC 1 cut(s) 67
BsmAI GTCTC 1 cut(s) 195
BsmBI CGTCTC 1 cut(s) 195
Bsp1286I GDGCHC 1 cut(s) 43
Bsp143I GATC 2 cut(s) 95, 140
BspCNI CTCAG 1 cut(s) 140
BspLI GGNNCC 1 cut(s) 261
BspMAI CTGCAG 1 cut(s) 95
BspMI ACCTGC 1 cut(s) 338
BspPI GGATC 1 cut(s) 135
BsrDI GCAATG 1 cut(s) 285
BssECI CCNNGG 1 cut(s) 296
BssMI GATC 2 cut(s) 95, 140
Bst4CI ACNGT 1 cut(s) 281
BstC8I GCNNGC 2 cut(s) 112, 133
BstDEI CTNAG 1 cut(s) 127
BstH2I RGCGCY 1 cut(s) 104
BstHHI GCGC 1 cut(s) 103
BstKTI GATC 2 cut(s) 98, 143
BstMAI GTCTC 1 cut(s) 195
BstMBI GATC 2 cut(s) 95, 140
BstMWI GCNNNNNNNGC 4 cut(s) 107, 120, 268, 339
BstSFI CTRYAG 1 cut(s) 91
BstSLI GKGCMC 1 cut(s) 43
BstX2I RGATCY 1 cut(s) 140
BstYI RGATCY 1 cut(s) 140
BtsIMutI CAGTG 1 cut(s) 286
BveI ACCTGC 1 cut(s) 338
Cac8I GCNNGC 2 cut(s) 112, 133
CfoI GCGC 1 cut(s) 103
DdeI CTNAG 1 cut(s) 127
DpnI GATC 2 cut(s) 97, 142
DpnII GATC 2 cut(s) 95, 140
Eco47III AGCGCT 1 cut(s) 102
Esp3I CGTCTC 1 cut(s) 195
FaiI YATR 2 cut(s) 107, 170
FalI AAGNNNNNCTT 1 cut(s) 342
FspBI CTAG 3 cut(s) 222, 231, 366
GlaI GCGC 1 cut(s) 102
GsaI CCCAGC 1 cut(s) 71
GsuI CTGGAG 2 cut(s) 121, 355
HaeII RGCGCY 1 cut(s) 104
HhaI GCGC 1 cut(s) 103
Hin6I GCGC 1 cut(s) 101
HinP1I GCGC 1 cut(s) 101
HinfI GANTC 1 cut(s) 13
HphI GGTGA 1 cut(s) 319
Hpy188III TCNNGA 4 cut(s) 17, 52, 138, 359
HpyCH4III ACNGT 1 cut(s) 281
HpyCH4V TGCA 3 cut(s) 9, 93, 123
HpyF10VI GCNNNNNNNGC 4 cut(s) 107, 120, 268, 339
HpyF3I CTNAG 1 cut(s) 127
HspAI GCGC 1 cut(s) 101
Kzo9I GATC 2 cut(s) 95, 140
LmnI GCTCC 2 cut(s) 140, 259
LpnPI CCDG 7 cut(s) 2, 37, 81, 96, 151, 319, 343
LweI GCATC 2 cut(s) 132, 258
MaeI CTAG 3 cut(s) 222, 231, 366
MalI GATC 2 cut(s) 97, 142
MboI GATC 2 cut(s) 95, 140
MfeI CAATTG 1 cut(s) 312
MflI RGATCY 1 cut(s) 140
MhlI GDGCHC 1 cut(s) 43
MluCI AATT 2 cut(s) 47, 312
MmeI TCCRAC 1 cut(s) 11
MnlI CCTC 2 cut(s) 155, 306
MseI TTAA 1 cut(s) 24
MunI CAATTG 1 cut(s) 312
MwoI GCNNNNNNNGC 4 cut(s) 107, 120, 268, 339
NdeII GATC 2 cut(s) 95, 140
NlaIV GGNNCC 1 cut(s) 261
NmeAIII GCCGAG 1 cut(s) 277
PaqCI CACCTGC 1 cut(s) 338
PfeI GAWTC 1 cut(s) 13
PspFI CCCAGC 1 cut(s) 67
PspN4I GGNNCC 1 cut(s) 261
PstI CTGCAG 1 cut(s) 95
PsuI RGATCY 1 cut(s) 140
SaqAI TTAA 1 cut(s) 24
Sau3AI GATC 2 cut(s) 95, 140
SduI GDGCHC 1 cut(s) 43
SetI ASST 8 cut(s) 112, 122, 133, 158, 227, 236, 332, 371
SfaNI GCATC 2 cut(s) 132, 258
SfcI CTRYAG 1 cut(s) 91
SmlI CTYRAG 2 cut(s) 115, 348
SmoI CTYRAG 2 cut(s) 115, 348
Sse9I AATT 2 cut(s) 47, 312
SspMI CTAG 3 cut(s) 222, 231, 366
TaaI ACNGT 1 cut(s) 281
TaqI TCGA 1 cut(s) 206
TasI AATT 2 cut(s) 47, 312
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TscAI CASTG 1 cut(s) 286
TspDTI ATGAA 4 cut(s) 17, 75, 192, 226
TspRI CASTG 1 cut(s) 286
XspI CTAG 3 cut(s) 222, 231, 366
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.