RchiOBHm_Chr4g0388161

Meiotic recombination protein DMC1 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
3325497 .. 3327726
2230 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 225 bp
ATGATTGCTCAGGGAATCAATGCCGGAGATGTTAAGAAGCTTCAGGACGCAGGGATCTACACCTGGCAATTCACCAAGAAGCTTCCTACTAACATGCATGGTGGGAATGGAAAGGTTGCTTACATTGATACTGAGGGAACTTTGTATCCTTTTCCTTTGTCCATCCAAACTAATGTTTCATGTTGCTTTTTATCAACAAAGGATGACCAAGAATTATCAACATAG

Protein Analysis

74

Amino Acids

8.12

Weight (kDa)

5.55

Isoelectric Point (pI)

22.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad51 PF08423 22 - 51 2.3e-06 Rad51
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 62
AcuI CTGAAG 1 cut(s) 26
AjnI CCWGG 1 cut(s) 62
AloI GAACNNNNNNTCC 2 cut(s) 130, 162
AluBI AGCT 2 cut(s) 40, 82
AluI AGCT 2 cut(s) 40, 82
AlwI GGATC 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 64
BccI CCATC 1 cut(s) 170
BciT130I CCWGG 1 cut(s) 64
BciVI GTATCC 1 cut(s) 156
BfuI GTATCC 1 cut(s) 156
Bme1390I CCNGG 1 cut(s) 64
BmrFI CCNGG 1 cut(s) 64
Bpu10I CCTNAGC 1 cut(s) 9
BseBI CCWGG 1 cut(s) 64
BseGI GGATG 2 cut(s) 162, 208
BseMII CTCAG 2 cut(s) 23, 123
BsiSI CCGG 1 cut(s) 24
Bsp143I GATC 1 cut(s) 54
BspCNI CTCAG 2 cut(s) 22, 124
BspPI GGATC 1 cut(s) 62
BssMI GATC 1 cut(s) 54
Bst2UI CCWGG 1 cut(s) 64
BstDEI CTNAG 2 cut(s) 9, 132
BstF5I GGATG 2 cut(s) 162, 208
BstKTI GATC 1 cut(s) 57
BstMBI GATC 1 cut(s) 54
BstNI CCWGG 1 cut(s) 64
BstNSI RCATGY 1 cut(s) 97
BstSCI CCNGG 1 cut(s) 62
BstX2I RGATCY 1 cut(s) 54
BstYI RGATCY 1 cut(s) 54
BsuI GTATCC 1 cut(s) 156
BtsCI GGATG 2 cut(s) 162, 208
CseI GACGC 1 cut(s) 56
CviAII CATG 3 cut(s) 94, 98, 180
CviJI RGCY 2 cut(s) 40, 82
CviKI_1 RGCY 2 cut(s) 40, 82
DdeI CTNAG 2 cut(s) 9, 132
DpnI GATC 1 cut(s) 56
DpnII GATC 1 cut(s) 54
Eco57I CTGAAG 1 cut(s) 26
EcoRII CCWGG 1 cut(s) 62
EcoT22I ATGCAT 1 cut(s) 99
FaeI CATG 3 cut(s) 97, 101, 183
FaiI YATR 4 cut(s) 95, 99, 181, 223
FatI CATG 3 cut(s) 93, 97, 179
FokI GGATG 2 cut(s) 149, 215
HapII CCGG 1 cut(s) 24
HgaI GACGC 1 cut(s) 56
Hin1II CATG 3 cut(s) 97, 101, 183
HindIII AAGCTT 2 cut(s) 38, 80
HinfI GANTC 1 cut(s) 15
HpaII CCGG 1 cut(s) 24
HphI GGTGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 44
HpyCH4V TGCA 1 cut(s) 97
HpyF3I CTNAG 2 cut(s) 9, 132
Hsp92II CATG 3 cut(s) 97, 101, 183
Kzo9I GATC 1 cut(s) 54
LpnPI CCDG 5 cut(s) 29, 36, 37, 49, 76
MalI GATC 1 cut(s) 56
MboI GATC 1 cut(s) 54
MflI RGATCY 1 cut(s) 54
MluCI AATT 2 cut(s) 68, 212
MnlI CCTC 1 cut(s) 127
Mph1103I ATGCAT 1 cut(s) 99
MseI TTAA 1 cut(s) 33
MspI CCGG 1 cut(s) 24
MspR9I CCNGG 1 cut(s) 64
MvaI CCWGG 1 cut(s) 64
NdeII GATC 1 cut(s) 54
NlaIII CATG 3 cut(s) 97, 101, 183
NsiI ATGCAT 1 cut(s) 99
NspI RCATGY 1 cut(s) 97
PfeI GAWTC 1 cut(s) 15
Psp6I CCWGG 1 cut(s) 62
PspGI CCWGG 1 cut(s) 62
PsuI RGATCY 1 cut(s) 54
SaqAI TTAA 1 cut(s) 33
Sau3AI GATC 1 cut(s) 54
ScrFI CCNGG 1 cut(s) 64
SetI ASST 4 cut(s) 42, 65, 84, 117
Sse9I AATT 2 cut(s) 68, 212
StyD4I CCNGG 1 cut(s) 62
TasI AATT 2 cut(s) 68, 212
TfiI GAWTC 1 cut(s) 15
Tru1I TTAA 1 cut(s) 33
Tru9I TTAA 1 cut(s) 33
TspDTI ATGAA 1 cut(s) 168
XceI RCATGY 1 cut(s) 97
Zsp2I ATGCAT 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.