Rroxscaffold_5G00347970

Meiotic recombination protein DMC1 homolog

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
19795518 .. 19797501
1984 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00347970.1

Sequence Viewer

Length: 216 bp
ATGATGATGCACACCAAGAGTAACTTGACTGGAATTAAAGGTTTATCTGAGGTCAAAGTCGATAAGATTTGTGAAGTTGCTGAGAAGATTGTGCTTCCTATTAACATGCATGGAGGGAGTGGAAATGTTGCTTACATTGATACTGAGAGAACTTTGTATCCTTTTTCTTTGTCCATCCAAACTAATGTTTCATGTAGCTTTTTATCAACAAAATGA

Protein Analysis

71

Amino Acids

7.78

Weight (kDa)

7.8

Isoelectric Point (pI)

22.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AloI GAACNNNNNNTCC 2 cut(s) 142, 174
AluBI AGCT 1 cut(s) 198
AluI AGCT 1 cut(s) 198
BccI CCATC 1 cut(s) 182
BciVI GTATCC 1 cut(s) 168
BfuI GTATCC 1 cut(s) 168
Bse1I ACTGG 1 cut(s) 34
BseGI GGATG 1 cut(s) 174
BseMII CTCAG 3 cut(s) 39, 72, 135
BseNI ACTGG 1 cut(s) 34
BspCNI CTCAG 3 cut(s) 40, 73, 136
BsrI ACTGG 1 cut(s) 34
BstDEI CTNAG 3 cut(s) 48, 81, 144
BstF5I GGATG 1 cut(s) 174
BstNSI RCATGY 1 cut(s) 109
BsuI GTATCC 1 cut(s) 168
BtsCI GGATG 1 cut(s) 174
CviAII CATG 3 cut(s) 106, 110, 192
CviJI RGCY 1 cut(s) 198
CviKI_1 RGCY 1 cut(s) 198
DdeI CTNAG 3 cut(s) 48, 81, 144
EcoT22I ATGCAT 1 cut(s) 111
FaeI CATG 3 cut(s) 109, 113, 195
FaiI YATR 3 cut(s) 107, 111, 193
FalI AAGNNNNNCTT 2 cut(s) 8, 40
FatI CATG 3 cut(s) 105, 109, 191
FokI GGATG 1 cut(s) 161
Hin1II CATG 3 cut(s) 109, 113, 195
Hpy188I TCNGA 1 cut(s) 49
HpyCH4V TGCA 2 cut(s) 10, 109
HpyF3I CTNAG 3 cut(s) 48, 81, 144
Hsp92II CATG 3 cut(s) 109, 113, 195
LpnPI CCDG 1 cut(s) 15
MaeIII GTNAC 1 cut(s) 20
MboII GAAGA 1 cut(s) 97
MluCI AATT 1 cut(s) 33
MnlI CCTC 2 cut(s) 43, 107
Mph1103I ATGCAT 1 cut(s) 111
MseI TTAA 2 cut(s) 36, 102
NlaIII CATG 3 cut(s) 109, 113, 195
NsiI ATGCAT 1 cut(s) 111
NspI RCATGY 1 cut(s) 109
SaqAI TTAA 2 cut(s) 36, 102
SetI ASST 3 cut(s) 43, 54, 200
SgeI CNNG 6 cut(s) 28, 37, 42, 118, 122, 204
Sse9I AATT 1 cut(s) 33
TaqI TCGA 1 cut(s) 60
TasI AATT 1 cut(s) 33
Tru1I TTAA 2 cut(s) 36, 102
Tru9I TTAA 2 cut(s) 36, 102
TspDTI ATGAA 1 cut(s) 180
XceI RCATGY 1 cut(s) 109
Zsp2I ATGCAT 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.