Rh7BG475700

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
56029551 .. 56032104
2554 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG475700.1

Sequence Viewer

Length: 186 bp
ATGGAATCTGTGTTTTGGAGGACTCGAATCTGCAGGAGCGTGGAGCTGGAATCGGGTTGGACCATGCTGCTGAGTGGGAATGAGAGGCTTCCTGGTGCTGTTGTGCCTGCTAGGGAGAGGCTACTTGAGAGGTTGAGAGGAATGTCTCATTCGGAAACCAGGTTAGTCTCTTTGTATGCTCTCTAA

Protein Analysis

61

Amino Acids

7.05

Weight (kDa)

9.47

Isoelectric Point (pI)

45.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 2 cut(s) 91, 158
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
Alw26I GTCTC 2 cut(s) 150, 172
ApeKI GCWGC 1 cut(s) 67
AspS9I GGNCC 1 cut(s) 60
AvaII GGWCC 1 cut(s) 60
BbvI GCAGC 1 cut(s) 54
BciT130I CCWGG 2 cut(s) 93, 160
BcoDI GTCTC 2 cut(s) 150, 172
BfaI CTAG 1 cut(s) 111
BfmI CTRYAG 1 cut(s) 31
BisI GCNGC 1 cut(s) 68
BlsI GCNGC 1 cut(s) 69
Bme1390I CCNGG 2 cut(s) 93, 160
Bme18I GGWCC 1 cut(s) 60
BmgT120I GGNCC 1 cut(s) 60
BmrFI CCNGG 2 cut(s) 93, 160
BpuEI CTTGAG 1 cut(s) 146
BseBI CCWGG 2 cut(s) 93, 160
BseMII CTCAG 1 cut(s) 62
BseXI GCAGC 1 cut(s) 54
BsmAI GTCTC 2 cut(s) 150, 172
BspCNI CTCAG 1 cut(s) 63
BspMAI CTGCAG 1 cut(s) 35
Bst2UI CCWGG 2 cut(s) 93, 160
BstC8I GCNNGC 1 cut(s) 108
BstDEI CTNAG 1 cut(s) 71
BstMAI GTCTC 2 cut(s) 150, 172
BstNI CCWGG 2 cut(s) 93, 160
BstSCI CCNGG 2 cut(s) 91, 158
BstSFI CTRYAG 1 cut(s) 31
BstV1I GCAGC 1 cut(s) 54
Cac8I GCNNGC 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 60
CsiI ACCWGGT 1 cut(s) 158
CviAII CATG 1 cut(s) 64
CviJI RGCY 3 cut(s) 46, 88, 121
CviKI_1 RGCY 3 cut(s) 46, 88, 121
DdeI CTNAG 1 cut(s) 71
Eco47I GGWCC 1 cut(s) 60
EcoRII CCWGG 2 cut(s) 91, 158
FaeI CATG 1 cut(s) 67
FaiI YATR 2 cut(s) 65, 177
FatI CATG 1 cut(s) 63
Fnu4HI GCNGC 1 cut(s) 68
Fsp4HI GCNGC 1 cut(s) 68
FspBI CTAG 1 cut(s) 111
GluI GCNGC 1 cut(s) 68
Hin1II CATG 1 cut(s) 67
HinfI GANTC 4 cut(s) 5, 22, 27, 50
Hpy188I TCNGA 1 cut(s) 154
HpyCH4V TGCA 1 cut(s) 33
HpyF3I CTNAG 1 cut(s) 71
Hsp92II CATG 1 cut(s) 67
LmnI GCTCC 2 cut(s) 36, 43
LpnPI CCDG 7 cut(s) 19, 32, 78, 105, 120, 145, 172
Lsp1109I GCAGC 1 cut(s) 54
MabI ACCWGGT 1 cut(s) 158
MaeI CTAG 1 cut(s) 111
MlyI GAGTC 1 cut(s) 16
MmeI TCCRAC 1 cut(s) 38
MnlI CCTC 5 cut(s) 12, 78, 111, 123, 131
MspR9I CCNGG 2 cut(s) 93, 160
MvaI CCWGG 2 cut(s) 93, 160
NlaIII CATG 1 cut(s) 67
PfeI GAWTC 3 cut(s) 5, 27, 50
PkrI GCNGC 1 cut(s) 69
PleI GAGTC 1 cut(s) 16
PpsI GAGTC 1 cut(s) 16
Psp6I CCWGG 2 cut(s) 91, 158
PspGI CCWGG 2 cut(s) 91, 158
PspPI GGNCC 1 cut(s) 60
PstI CTGCAG 1 cut(s) 35
SatI GCNGC 1 cut(s) 68
Sau96I GGNCC 1 cut(s) 60
SchI GAGTC 1 cut(s) 16
ScrFI CCNGG 2 cut(s) 93, 160
SetI ASST 3 cut(s) 48, 134, 164
SexAI ACCWGGT 1 cut(s) 158
SfcI CTRYAG 1 cut(s) 31
SinI GGWCC 1 cut(s) 60
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
SspMI CTAG 1 cut(s) 111
StyD4I CCNGG 2 cut(s) 91, 158
TaqI TCGA 1 cut(s) 25
TfiI GAWTC 3 cut(s) 5, 27, 50
TseI GCWGC 1 cut(s) 67
VpaK11BI GGWCC 1 cut(s) 60
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.