RchiOBHm_Chr5g0042521

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
37338766 .. 37340827
2062 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32091

Sequence Viewer

Length: 213 bp
ATGTTGAAGCTTAGGGACGCAGGGATCTACACCTGGCAACTTCACCAAGAAGGTATGTTCATACTTTACAATAGGACAATATTGCAACAGATTCAAGTGCACACCATGATGAAGATGGTATTGATGAAGATGGTGCTGAAGATGTTGCTGATGAAGATGATGCAAACTCTAATGAGGACTTCTATTAGATATATTGTTAGCTTCCTTGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.49

Weight (kDa)

10.45

Isoelectric Point (pI)

31.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 32
AcuI CTGAAG 1 cut(s) 158
AgsI TTSAA 2 cut(s) 7, 95
AjnI CCWGG 1 cut(s) 32
AluBI AGCT 2 cut(s) 10, 201
AluI AGCT 2 cut(s) 10, 201
Alw21I GWGCWC 1 cut(s) 102
Alw44I GTGCAC 1 cut(s) 98
AlwI GGATC 1 cut(s) 32
ApaLI GTGCAC 1 cut(s) 98
AsuHPI GGTGA 1 cut(s) 35
BaeGI GKGCMC 1 cut(s) 102
Bbv12I GWGCWC 1 cut(s) 102
BccI CCATC 2 cut(s) 109, 124
BciT130I CCWGG 1 cut(s) 34
Bme1390I CCNGG 1 cut(s) 34
BmrFI CCNGG 1 cut(s) 34
BmsI GCATC 1 cut(s) 150
Bpu10I CCTNAGC 1 cut(s) 11
BseBI CCWGG 1 cut(s) 34
BseSI GKGCMC 1 cut(s) 102
BsiHKAI GWGCWC 1 cut(s) 102
BslFI GGGAC 1 cut(s) 29
BsmFI GGGAC 1 cut(s) 29
Bsp1286I GDGCHC 1 cut(s) 102
Bsp143I GATC 1 cut(s) 24
BspPI GGATC 1 cut(s) 32
BssMI GATC 1 cut(s) 24
Bst2UI CCWGG 1 cut(s) 34
BstDEI CTNAG 1 cut(s) 11
BstKTI GATC 1 cut(s) 27
BstMBI GATC 1 cut(s) 24
BstNI CCWGG 1 cut(s) 34
BstSCI CCNGG 1 cut(s) 32
BstSLI GKGCMC 1 cut(s) 102
BstX2I RGATCY 1 cut(s) 24
BstYI RGATCY 1 cut(s) 24
CseI GACGC 1 cut(s) 26
CviAII CATG 1 cut(s) 106
CviJI RGCY 2 cut(s) 10, 201
CviKI_1 RGCY 2 cut(s) 10, 201
DdeI CTNAG 1 cut(s) 11
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
Eco57I CTGAAG 1 cut(s) 158
EcoRII CCWGG 1 cut(s) 32
FaeI CATG 1 cut(s) 109
FaiI YATR 4 cut(s) 56, 62, 107, 192
FaqI GGGAC 1 cut(s) 29
FatI CATG 1 cut(s) 105
HgaI GACGC 1 cut(s) 26
Hin1II CATG 1 cut(s) 109
HindIII AAGCTT 1 cut(s) 8
HinfI GANTC 1 cut(s) 91
HphI GGTGA 1 cut(s) 35
Hpy166II GTNNAC 1 cut(s) 100
Hpy8I GTNNAC 1 cut(s) 100
HpyAV CCTTC 1 cut(s) 44
HpyCH4V TGCA 3 cut(s) 85, 100, 163
HpyF3I CTNAG 1 cut(s) 11
Hsp92II CATG 1 cut(s) 109
Kzo9I GATC 1 cut(s) 24
LpnPI CCDG 3 cut(s) 6, 19, 46
LweI GCATC 1 cut(s) 150
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MboII GAAGA 4 cut(s) 124, 139, 151, 166
MflI RGATCY 1 cut(s) 24
MhlI GDGCHC 1 cut(s) 102
MnlI CCTC 1 cut(s) 168
MseI TTAA 1 cut(s) 211
MslI CAYNNNNRTG 1 cut(s) 107
MspR9I CCNGG 1 cut(s) 34
MvaI CCWGG 1 cut(s) 34
NdeII GATC 1 cut(s) 24
NlaIII CATG 1 cut(s) 109
PfeI GAWTC 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 32
PspGI CCWGG 1 cut(s) 32
PsuI RGATCY 1 cut(s) 24
RseI CAYNNNNRTG 1 cut(s) 107
SaqAI TTAA 1 cut(s) 211
Sau3AI GATC 1 cut(s) 24
ScrFI CCNGG 1 cut(s) 34
SduI GDGCHC 1 cut(s) 102
SetI ASST 4 cut(s) 12, 35, 55, 203
SfaNI GCATC 1 cut(s) 150
SgeI CNNG 6 cut(s) 33, 45, 46, 59, 107, 118
SmiMI CAYNNNNRTG 1 cut(s) 107
SspI AATATT 1 cut(s) 81
StyD4I CCNGG 1 cut(s) 32
TfiI GAWTC 1 cut(s) 91
Tru1I TTAA 1 cut(s) 211
Tru9I TTAA 1 cut(s) 211
TspDTI ATGAA 4 cut(s) 49, 125, 140, 167
VneI GTGCAC 1 cut(s) 98
XcmI CCANNNNNNNNNTGG 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.