RchiOBHm_Chr6g0248831

The pyruvate dehydrogenase complex catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
4718581 .. 4721405
2825 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22305

Sequence Viewer

Length: 210 bp
ATGTTCGCAAATTCAATCAAGGTCCAAACGGTGCTGCTGCTGGTGTTGGTGTCCAGCACTCTCAACATGGTATGCTGCCGTCCTGGGTTGAAAGTTTTGACCCCTTATTCATTTGAAGATGCTCATGGACTGCTAAAAGCTGCCATTAGGGACCCTGATCGTGTTGTTTTTCTTGAAAATGAGTTGCTGAATCAATGCCGGAGATGTTGA

Protein Analysis

69

Amino Acids

7.76

Weight (kDa)

8.47

Isoelectric Point (pI)

13.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 10
AgsI TTSAA 4 cut(s) 15, 91, 116, 176
AjnI CCWGG 1 cut(s) 82
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
ApeKI GCWGC 4 cut(s) 34, 37, 75, 140
ApoI RAATTY 1 cut(s) 10
AspS9I GGNCC 2 cut(s) 22, 151
AvaII GGWCC 2 cut(s) 22, 151
BbvI GCAGC 4 cut(s) 21, 24, 62, 127
BceAI ACGGC 1 cut(s) 63
BciT130I CCWGG 1 cut(s) 84
BisI GCNGC 4 cut(s) 35, 38, 76, 141
BlsI GCNGC 4 cut(s) 36, 39, 77, 142
Bme1390I CCNGG 1 cut(s) 84
Bme18I GGWCC 2 cut(s) 22, 151
BmgT120I GGNCC 2 cut(s) 22, 151
BmiI GGNNCC 2 cut(s) 152, 153
BmrFI CCNGG 1 cut(s) 84
BmsI GCATC 1 cut(s) 109
BsaJI CCNNGG 1 cut(s) 83
BseBI CCWGG 1 cut(s) 84
BseDI CCNNGG 1 cut(s) 83
BseXI GCAGC 4 cut(s) 21, 24, 62, 127
BsiSI CCGG 1 cut(s) 199
BslFI GGGAC 1 cut(s) 164
BsmFI GGGAC 1 cut(s) 164
Bsp143I GATC 1 cut(s) 157
BspLI GGNNCC 2 cut(s) 152, 153
BssECI CCNNGG 1 cut(s) 83
BssMI GATC 1 cut(s) 157
Bst2UI CCWGG 1 cut(s) 84
Bst4CI ACNGT 1 cut(s) 31
BstKTI GATC 1 cut(s) 160
BstMBI GATC 1 cut(s) 157
BstNI CCWGG 1 cut(s) 84
BstSCI CCNGG 1 cut(s) 82
BstV1I GCAGC 4 cut(s) 21, 24, 62, 127
Cfr13I GGNCC 2 cut(s) 22, 151
CviAII CATG 2 cut(s) 67, 125
CviJI RGCY 1 cut(s) 140
CviKI_1 RGCY 1 cut(s) 140
DpnI GATC 1 cut(s) 159
DpnII GATC 1 cut(s) 157
Eco47I GGWCC 2 cut(s) 22, 151
EcoO109I RGGNCCY 1 cut(s) 151
EcoRII CCWGG 1 cut(s) 82
FaeI CATG 2 cut(s) 70, 128
FaiI YATR 3 cut(s) 68, 73, 126
FaqI GGGAC 1 cut(s) 164
FatI CATG 2 cut(s) 66, 124
Fnu4HI GCNGC 4 cut(s) 35, 38, 76, 141
Fsp4HI GCNGC 4 cut(s) 35, 38, 76, 141
GluI GCNGC 4 cut(s) 35, 38, 76, 141
HapII CCGG 1 cut(s) 199
Hin1II CATG 2 cut(s) 70, 128
HinfI GANTC 1 cut(s) 190
HpaII CCGG 1 cut(s) 199
Hpy188III TCNNGA 1 cut(s) 173
HpyCH4III ACNGT 1 cut(s) 31
Hsp92II CATG 2 cut(s) 70, 128
KflI GGGWCCC 1 cut(s) 151
Kzo9I GATC 1 cut(s) 157
LpnPI CCDG 5 cut(s) 26, 67, 69, 96, 168
Lsp1109I GCAGC 4 cut(s) 21, 24, 62, 127
LweI GCATC 1 cut(s) 109
MalI GATC 1 cut(s) 159
MboI GATC 1 cut(s) 157
MboII GAAGA 1 cut(s) 128
MluCI AATT 1 cut(s) 10
MspI CCGG 1 cut(s) 199
MspR9I CCNGG 1 cut(s) 84
MvaI CCWGG 1 cut(s) 84
NdeII GATC 1 cut(s) 157
NlaIII CATG 2 cut(s) 70, 128
NlaIV GGNNCC 2 cut(s) 152, 153
PfeI GAWTC 1 cut(s) 190
PkrI GCNGC 4 cut(s) 36, 39, 77, 142
PpuMI RGGWCCY 1 cut(s) 151
Psp5II RGGWCCY 1 cut(s) 151
Psp6I CCWGG 1 cut(s) 82
PspGI CCWGG 1 cut(s) 82
PspN4I GGNNCC 2 cut(s) 152, 153
PspPI GGNCC 2 cut(s) 22, 151
PspPPI RGGWCCY 1 cut(s) 151
SatI GCNGC 4 cut(s) 35, 38, 76, 141
Sau3AI GATC 1 cut(s) 157
Sau96I GGNCC 2 cut(s) 22, 151
ScrFI CCNGG 1 cut(s) 84
SetI ASST 2 cut(s) 24, 142
SfaNI GCATC 1 cut(s) 109
SinI GGWCC 2 cut(s) 22, 151
Sse9I AATT 1 cut(s) 10
StyD4I CCNGG 1 cut(s) 82
TaaI ACNGT 1 cut(s) 31
TasI AATT 1 cut(s) 10
TfiI GAWTC 1 cut(s) 190
TseI GCWGC 4 cut(s) 34, 37, 75, 140
TspDTI ATGAA 1 cut(s) 99
VpaK11BI GGWCC 2 cut(s) 22, 151
XapI RAATTY 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.