RchiOBHm_Chr4g0422601

AhpC/TSA antioxidant enzyme

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
48185171 .. 48186325
1155 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGTTGGCAGGATATATATATATAGTGGATGAATCTGGTGTGGCTCTTGTTTTGATTGGACATGGTAGCATTGATCAGGGTGCTAGTTGCAAGTCCTGGACTCCTGGTAAAAGTAACATCTTGTACATTCACAAGGACAAAGAAGCTGGGGATGATCCAGATATCAAAGGTATCCTCAAAGCATGTTGTGGGGTTTAA

Protein Analysis

65

Amino Acids

6.84

Weight (kDa)

5.42

Isoelectric Point (pI)

23.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 149
AfaI GTAC 1 cut(s) 125
AjnI CCWGG 2 cut(s) 95, 103
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
AlwI GGATC 1 cut(s) 149
BciT130I CCWGG 2 cut(s) 97, 105
BciVI GTATCC 1 cut(s) 182
BclI TGATCA 1 cut(s) 73
BfaI CTAG 1 cut(s) 84
BfuI GTATCC 1 cut(s) 182
Bme1390I CCNGG 2 cut(s) 97, 105
BmrFI CCNGG 2 cut(s) 97, 105
BseBI CCWGG 2 cut(s) 97, 105
BseGI GGATG 2 cut(s) 34, 157
BseYI CCCAGC 1 cut(s) 146
Bsp1407I TGTACA 1 cut(s) 123
Bsp143I GATC 2 cut(s) 73, 154
BspPI GGATC 1 cut(s) 149
BsrGI TGTACA 1 cut(s) 123
BssMI GATC 2 cut(s) 73, 154
Bst2UI CCWGG 2 cut(s) 97, 105
BstAUI TGTACA 1 cut(s) 123
BstF5I GGATG 2 cut(s) 34, 157
BstKTI GATC 2 cut(s) 76, 157
BstMBI GATC 2 cut(s) 73, 154
BstNI CCWGG 2 cut(s) 97, 105
BstNSI RCATGY 1 cut(s) 186
BstSCI CCNGG 2 cut(s) 95, 103
BsuI GTATCC 1 cut(s) 182
BtsCI GGATG 2 cut(s) 34, 157
Csp6I GTAC 1 cut(s) 124
CviAII CATG 2 cut(s) 62, 183
CviJI RGCY 2 cut(s) 44, 146
CviKI_1 RGCY 2 cut(s) 44, 146
CviQI GTAC 1 cut(s) 124
DpnI GATC 2 cut(s) 75, 156
DpnII GATC 2 cut(s) 73, 154
Eco32I GATATC 1 cut(s) 163
EcoRII CCWGG 2 cut(s) 95, 103
EcoRV GATATC 1 cut(s) 163
FaeI CATG 2 cut(s) 65, 186
FaiI YATR 7 cut(s) 15, 17, 19, 21, 23, 63, 184
FatI CATG 2 cut(s) 61, 182
FbaI TGATCA 1 cut(s) 73
FokI GGATG 2 cut(s) 41, 164
FspBI CTAG 1 cut(s) 84
GsaI CCCAGC 1 cut(s) 150
Hin1II CATG 2 cut(s) 65, 186
HinfI GANTC 2 cut(s) 32, 100
Hpy188III TCNNGA 1 cut(s) 158
HpyCH4V TGCA 1 cut(s) 90
Hsp92II CATG 2 cut(s) 65, 186
Ksp22I TGATCA 1 cut(s) 73
Kzo9I GATC 2 cut(s) 73, 154
LpnPI CCDG 8 cut(s) 21, 62, 82, 90, 109, 117, 132, 171
MaeI CTAG 1 cut(s) 84
MaeIII GTNAC 1 cut(s) 113
MalI GATC 2 cut(s) 75, 156
MboI GATC 2 cut(s) 73, 154
MlyI GAGTC 1 cut(s) 94
MnlI CCTC 1 cut(s) 185
MseI TTAA 1 cut(s) 196
MspR9I CCNGG 2 cut(s) 97, 105
MvaI CCWGG 2 cut(s) 97, 105
NdeII GATC 2 cut(s) 73, 154
NlaIII CATG 2 cut(s) 65, 186
NspI RCATGY 1 cut(s) 186
PfeI GAWTC 1 cut(s) 32
PfoI TCCNGGA 1 cut(s) 95
PleI GAGTC 1 cut(s) 94
PpsI GAGTC 1 cut(s) 94
Psp6I CCWGG 2 cut(s) 95, 103
PspFI CCCAGC 1 cut(s) 146
PspGI CCWGG 2 cut(s) 95, 103
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
SaqAI TTAA 1 cut(s) 196
Sau3AI GATC 2 cut(s) 73, 154
SchI GAGTC 1 cut(s) 94
ScrFI CCNGG 2 cut(s) 97, 105
SetI ASST 2 cut(s) 148, 172
SspMI CTAG 1 cut(s) 84
StyD4I CCNGG 2 cut(s) 95, 103
TatI WGTACW 1 cut(s) 123
TfiI GAWTC 1 cut(s) 32
Tru1I TTAA 1 cut(s) 196
Tru9I TTAA 1 cut(s) 196
TspDTI ATGAA 1 cut(s) 45
XceI RCATGY 1 cut(s) 186
XspI CTAG 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.