Rh4DG238800

AhpC/TSA antioxidant enzyme

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
44618288 .. 44621147
2860 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG238800.1

Sequence Viewer

Length: 237 bp
ATGCTTTTGGAAACAATCTTTAAGGCTCACAGAGATACAGTAGTGGCGTTTAGGGATGCAAGTAAGAGTAACCAGTTCGATGGTCCATGGATACGACAGGAGGGTTATCGACAAGACTGGAAGCTTTCCTTTGAACAGGACATCATGAGCAGAGGCGGCTGGTATATCAATATAAAAGACAAAGAAGCTGGGGATGATCCAGATATCAAAGATATCCTCAAAGCATGTGAAACATAG

Protein Analysis

78

Amino Acids

9.14

Weight (kDa)

5.01

Isoelectric Point (pI)

33.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 156
AclWI GGATC 1 cut(s) 191
AgsI TTSAA 1 cut(s) 134
AluBI AGCT 2 cut(s) 124, 188
AluI AGCT 2 cut(s) 124, 188
AlwI GGATC 1 cut(s) 191
AspS9I GGNCC 1 cut(s) 83
AvaII GGWCC 1 cut(s) 83
BaeI ACNNNNGTAYC 2 cut(s) 27, 60
BccI CCATC 1 cut(s) 74
BciVI GTATCC 1 cut(s) 84
BfuI GTATCC 1 cut(s) 84
BisI GCNGC 1 cut(s) 157
BlsI GCNGC 1 cut(s) 158
Bme18I GGWCC 1 cut(s) 83
BmgT120I GGNCC 1 cut(s) 83
BmsI GCATC 1 cut(s) 46
BsaJI CCNNGG 1 cut(s) 86
Bse1I ACTGG 2 cut(s) 73, 122
BseDI CCNNGG 1 cut(s) 86
BseGI GGATG 2 cut(s) 61, 199
BseNI ACTGG 2 cut(s) 73, 122
BseYI CCCAGC 1 cut(s) 188
Bsp143I GATC 1 cut(s) 196
Bsp19I CCATGG 1 cut(s) 86
BspACI CCGC 1 cut(s) 156
BspHI TCATGA 1 cut(s) 144
BspPI GGATC 1 cut(s) 191
BsrI ACTGG 2 cut(s) 73, 122
BssECI CCNNGG 1 cut(s) 86
BssMI GATC 1 cut(s) 196
BssT1I CCWWGG 1 cut(s) 86
Bst4CI ACNGT 1 cut(s) 40
BstDSI CCRYGG 1 cut(s) 86
BstF5I GGATG 2 cut(s) 61, 199
BstKTI GATC 1 cut(s) 199
BstMBI GATC 1 cut(s) 196
BstMWI GCNNNNNNNGC 1 cut(s) 156
BstNSI RCATGY 1 cut(s) 228
BstXI CCANNNNNNTGG 1 cut(s) 80
BsuI GTATCC 1 cut(s) 84
BtgI CCRYGG 1 cut(s) 86
BtsCI GGATG 2 cut(s) 61, 199
CciI TCATGA 1 cut(s) 144
Cfr13I GGNCC 1 cut(s) 83
CviAII CATG 3 cut(s) 87, 145, 225
CviJI RGCY 4 cut(s) 26, 124, 159, 188
CviKI_1 RGCY 4 cut(s) 26, 124, 159, 188
DpnI GATC 1 cut(s) 198
DpnII GATC 1 cut(s) 196
Eco130I CCWWGG 1 cut(s) 86
Eco32I GATATC 2 cut(s) 205, 214
Eco47I GGWCC 1 cut(s) 83
EcoRV GATATC 2 cut(s) 205, 214
EcoT14I CCWWGG 1 cut(s) 86
ErhI CCWWGG 1 cut(s) 86
FaeI CATG 3 cut(s) 90, 148, 228
FaiI YATR 6 cut(s) 88, 146, 165, 173, 226, 235
FalI AAGNNNNNCTT 2 cut(s) 113, 145
FatI CATG 3 cut(s) 86, 144, 224
Fnu4HI GCNGC 1 cut(s) 157
FokI GGATG 2 cut(s) 68, 206
Fsp4HI GCNGC 1 cut(s) 157
GluI GCNGC 1 cut(s) 157
GsaI CCCAGC 1 cut(s) 192
Hin1II CATG 3 cut(s) 90, 148, 228
HindIII AAGCTT 1 cut(s) 122
Hpy188III TCNNGA 2 cut(s) 145, 200
HpyCH4III ACNGT 1 cut(s) 40
HpyCH4V TGCA 1 cut(s) 59
HpyF10VI GCNNNNNNNGC 1 cut(s) 156
Hsp92II CATG 3 cut(s) 90, 148, 228
Kzo9I GATC 1 cut(s) 196
LpnPI CCDG 7 cut(s) 83, 86, 103, 122, 145, 174, 213
LweI GCATC 1 cut(s) 46
MaeIII GTNAC 1 cut(s) 68
MalI GATC 1 cut(s) 198
MboI GATC 1 cut(s) 196
MnlI CCTC 3 cut(s) 94, 146, 227
MseI TTAA 1 cut(s) 21
MwoI GCNNNNNNNGC 1 cut(s) 156
NcoI CCATGG 1 cut(s) 86
NdeII GATC 1 cut(s) 196
NlaIII CATG 3 cut(s) 90, 148, 228
NspI RCATGY 1 cut(s) 228
PagI TCATGA 1 cut(s) 144
PkrI GCNGC 1 cut(s) 158
PspFI CCCAGC 1 cut(s) 188
PspPI GGNCC 1 cut(s) 83
SaqAI TTAA 1 cut(s) 21
SatI GCNGC 1 cut(s) 157
Sau3AI GATC 1 cut(s) 196
Sau96I GGNCC 1 cut(s) 83
SetI ASST 2 cut(s) 126, 190
SfaNI GCATC 1 cut(s) 46
SinI GGWCC 1 cut(s) 83
SsiI CCGC 1 cut(s) 156
StyI CCWWGG 1 cut(s) 86
TaaI ACNGT 1 cut(s) 40
TaqI TCGA 2 cut(s) 78, 109
TauI GCSGC 1 cut(s) 159
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
VpaK11BI GGWCC 1 cut(s) 83
XceI RCATGY 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.