RchiOBHm_Chr4g0442961

Pentacotripeptide-repeat region of PRORP

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
64345908 .. 64346496
589 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 282 bp
ATGATTCCAAGAAGTATGAGTAAAATGCGGGATGGAGGGGTTAGTCTTGTTGTGGCTGCATACGGAGTGGTGATCTCAGGCCTCTGTAAGAATGGTCAGTTAAATAAAGCAATGCGGGTCGTTACAGATTTGGCCATGTGTGGTTTTTCTTCAGATAAGATGTTGTTGATGACCATTATGGATGCATGTTTCAAAGCTGGGAATTTAAAAGCAGCTTCGGGTTTCTACAGAGAATTGTTAGCCAAGGGGTTTGAACCAGATGCTGTGGTGCTTCAGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

9.95

Weight (kDa)

9.18

Isoelectric Point (pI)

31.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_1 PF12854 18 - 41 7.2e-06 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 28, 115
AcoI YGGCCR 1 cut(s) 132
AcsI RAATTY 1 cut(s) 202
AcuI CTGAAG 2 cut(s) 135, 257
AgsI TTSAA 2 cut(s) 193, 254
AluBI AGCT 3 cut(s) 197, 215, 277
AluI AGCT 3 cut(s) 197, 215, 277
AlwNI CAGNNNCTG 1 cut(s) 263
AoxI GGCC 2 cut(s) 79, 132
ApeKI GCWGC 2 cut(s) 56, 212
ApoI RAATTY 1 cut(s) 202
AsuHPI GGTGA 1 cut(s) 82
BalI TGGCCA 1 cut(s) 134
BbvI GCAGC 2 cut(s) 43, 224
BccI CCATC 1 cut(s) 26
BfmI CTRYAG 1 cut(s) 226
BisI GCNGC 2 cut(s) 57, 213
BlsI GCNGC 2 cut(s) 58, 214
BmsI GCATC 2 cut(s) 172, 250
BsaJI CCNNGG 1 cut(s) 243
Bse3DI GCAATG 1 cut(s) 117
BseDI CCNNGG 1 cut(s) 243
BseGI GGATG 2 cut(s) 37, 187
BseMI GCAATG 1 cut(s) 117
BseMII CTCAG 1 cut(s) 90
BseXI GCAGC 2 cut(s) 43, 224
BseYI CCCAGC 1 cut(s) 197
BshFI GGCC 2 cut(s) 81, 134
BsnI GGCC 2 cut(s) 81, 134
Bsp143I GATC 1 cut(s) 72
BspACI CCGC 2 cut(s) 28, 115
BspANI GGCC 2 cut(s) 81, 134
BspCNI CTCAG 1 cut(s) 89
BsrDI GCAATG 1 cut(s) 117
BssECI CCNNGG 1 cut(s) 243
BssMI GATC 1 cut(s) 72
BssT1I CCWWGG 1 cut(s) 243
BstDEI CTNAG 1 cut(s) 76
BstF5I GGATG 2 cut(s) 37, 187
BstKTI GATC 1 cut(s) 75
BstMBI GATC 1 cut(s) 72
BstNSI RCATGY 1 cut(s) 189
BstSFI CTRYAG 1 cut(s) 226
BstV1I GCAGC 2 cut(s) 43, 224
BsuRI GGCC 2 cut(s) 81, 134
BtsCI GGATG 2 cut(s) 37, 187
CaiI CAGNNNCTG 1 cut(s) 263
CviAII CATG 2 cut(s) 136, 186
CviJI RGCY 7 cut(s) 56, 81, 134, 197, 215, 242, 277
CviKI_1 RGCY 7 cut(s) 56, 81, 134, 197, 215, 242, 277
DdeI CTNAG 1 cut(s) 76
DpnI GATC 1 cut(s) 74
DpnII GATC 1 cut(s) 72
DraI TTTAAA 1 cut(s) 207
EaeI YGGCCR 1 cut(s) 132
Eco130I CCWWGG 1 cut(s) 243
Eco147I AGGCCT 1 cut(s) 81
Eco57I CTGAAG 2 cut(s) 135, 257
EcoT14I CCWWGG 1 cut(s) 243
EcoT22I ATGCAT 1 cut(s) 187
ErhI CCWWGG 1 cut(s) 243
FaeI CATG 2 cut(s) 139, 189
FaiI YATR 5 cut(s) 17, 61, 137, 179, 187
FatI CATG 2 cut(s) 135, 185
FauI CCCGC 2 cut(s) 21, 108
Fnu4HI GCNGC 2 cut(s) 57, 213
FokI GGATG 2 cut(s) 44, 194
Fsp4HI GCNGC 2 cut(s) 57, 213
GluI GCNGC 2 cut(s) 57, 213
GsaI CCCAGC 1 cut(s) 201
HaeIII GGCC 2 cut(s) 81, 134
Hin1II CATG 2 cut(s) 139, 189
HinfI GANTC 1 cut(s) 4
HphI GGTGA 1 cut(s) 82
Hpy188I TCNGA 1 cut(s) 154
HpyCH4V TGCA 2 cut(s) 59, 185
HpyF3I CTNAG 1 cut(s) 76
Hsp92II CATG 2 cut(s) 139, 189
Kzo9I GATC 1 cut(s) 72
LpnPI CCDG 3 cut(s) 63, 183, 270
Lsp1109I GCAGC 2 cut(s) 43, 224
LweI GCATC 2 cut(s) 172, 250
MaeIII GTNAC 1 cut(s) 121
MalI GATC 1 cut(s) 74
MboI GATC 1 cut(s) 72
MboII GAAGA 1 cut(s) 141
MlsI TGGCCA 1 cut(s) 134
MluCI AATT 2 cut(s) 202, 233
MluNI TGGCCA 1 cut(s) 134
MnlI CCTC 2 cut(s) 29, 92
Mox20I TGGCCA 1 cut(s) 134
Mph1103I ATGCAT 1 cut(s) 187
MscI TGGCCA 1 cut(s) 134
MseI TTAA 2 cut(s) 101, 206
Msp20I TGGCCA 1 cut(s) 134
NdeII GATC 1 cut(s) 72
NlaIII CATG 2 cut(s) 139, 189
NsiI ATGCAT 1 cut(s) 187
NspI RCATGY 1 cut(s) 189
PceI AGGCCT 1 cut(s) 81
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 2 cut(s) 58, 214
PspFI CCCAGC 1 cut(s) 197
PstNI CAGNNNCTG 1 cut(s) 263
SaqAI TTAA 2 cut(s) 101, 206
SatI GCNGC 2 cut(s) 57, 213
Sau3AI GATC 1 cut(s) 72
SetI ASST 3 cut(s) 199, 217, 279
SfaNI GCATC 2 cut(s) 172, 250
SfcI CTRYAG 1 cut(s) 226
Sse9I AATT 2 cut(s) 202, 233
SseBI AGGCCT 1 cut(s) 81
SsiI CCGC 2 cut(s) 28, 115
StuI AGGCCT 1 cut(s) 81
StyI CCWWGG 1 cut(s) 243
TasI AATT 2 cut(s) 202, 233
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 2 cut(s) 101, 206
Tru9I TTAA 2 cut(s) 101, 206
TseI GCWGC 2 cut(s) 56, 212
TspGWI ACGGA 1 cut(s) 78
XapI RAATTY 1 cut(s) 202
XceI RCATGY 1 cut(s) 189
Zsp2I ATGCAT 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.