Rmu_ssc0000204.1_g000010

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000204.1
Physical Location & Seq
Forward (+)
33929 .. 34718
790 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000204.1_g000010.1.cds

Sequence Viewer

Length: 447 bp
atgcgggatggaggggttagtcttgttgtggctgcatacggagtggtgatctcaggcctctgtaagaatggtcagttaaataaagcaatgcgggtcgttacagatttggccatgtgtggtttttcttcagataagatgttgttgatgaccattatggatgcatgtttcaaagctgggaatttaaaagcagcttcgggtttctacagagaattgttcgccaaggggtttgaaccagatgctgtggcacaccctgcattgttatccattagaaagttgtcttcaaaaggggaagctggctcagagttcgtgcaattgtggaactattggaatgttccatctgcggtcctcgcattggtgtggagcaaggacctccagttctatgtgccttgttctgtgacagggccttcaaggcttttcccgaggcttactactcgagggatgcaataa

Protein Analysis

148

Amino Acids

16.09

Weight (kDa)

9.33

Isoelectric Point (pI)

26.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 4, 91, 341
AcoI YGGCCR 1 cut(s) 108
AcsI RAATTY 1 cut(s) 178
AcuI CTGAAG 1 cut(s) 111
AfiI CCNNNNNNNGG 1 cut(s) 352
AgsI TTSAA 4 cut(s) 169, 230, 282, 408
AloI GAACNNNNNNTCC 2 cut(s) 359, 391
AluBI AGCT 3 cut(s) 173, 191, 293
AluI AGCT 3 cut(s) 173, 191, 293
AlwNI CAGNNNCTG 1 cut(s) 239
Ama87I CYCGRG 2 cut(s) 418, 432
AoxI GGCC 3 cut(s) 55, 108, 401
ApeKI GCWGC 2 cut(s) 32, 188
ApoI RAATTY 1 cut(s) 178
AspS9I GGNCC 3 cut(s) 343, 367, 401
AsuHPI GGTGA 1 cut(s) 58
AvaI CYCGRG 2 cut(s) 418, 432
AvaII GGWCC 2 cut(s) 343, 367
BalI TGGCCA 1 cut(s) 110
BbsI GAAGAC 1 cut(s) 270
BbvI GCAGC 2 cut(s) 19, 200
BccI CCATC 2 cut(s) 2, 343
BfmI CTRYAG 1 cut(s) 202
BglI GCCNNNNNGGC 1 cut(s) 409
BisI GCNGC 2 cut(s) 33, 189
BlsI GCNGC 2 cut(s) 34, 190
Bme18I GGWCC 2 cut(s) 343, 367
BmeT110I CYCGRG 2 cut(s) 418, 432
BmgT120I GGNCC 3 cut(s) 343, 367, 401
BmsI GCATC 3 cut(s) 148, 226, 429
BpiI GAAGAC 1 cut(s) 270
BpmI CTGGAG 1 cut(s) 356
BsaJI CCNNGG 2 cut(s) 219, 419
Bsc4I CCNNNNNNNGG 1 cut(s) 352
Bse1I ACTGG 1 cut(s) 373
Bse3DI GCAATG 1 cut(s) 93
BseDI CCNNGG 2 cut(s) 219, 419
BseGI GGATG 3 cut(s) 13, 163, 444
BseLI CCNNNNNNNGG 1 cut(s) 352
BseMI GCAATG 1 cut(s) 93
BseMII CTCAG 2 cut(s) 66, 312
BseNI ACTGG 1 cut(s) 373
BseXI GCAGC 2 cut(s) 19, 200
BseYI CCCAGC 1 cut(s) 173
BshFI GGCC 3 cut(s) 57, 110, 403
BsiHKCI CYCGRG 2 cut(s) 418, 432
BslI CCNNNNNNNGG 1 cut(s) 352
BsnI GGCC 3 cut(s) 57, 110, 403
BsoBI CYCGRG 2 cut(s) 418, 432
Bsp143I GATC 1 cut(s) 48
BspACI CCGC 3 cut(s) 4, 91, 341
BspANI GGCC 3 cut(s) 57, 110, 403
BspCNI CTCAG 2 cut(s) 65, 311
BsrDI GCAATG 1 cut(s) 93
BsrI ACTGG 1 cut(s) 373
BssECI CCNNGG 2 cut(s) 219, 419
BssMI GATC 1 cut(s) 48
BssT1I CCWWGG 1 cut(s) 219
BstAPI GCANNNNNTGC 1 cut(s) 251
BstC8I GCNNGC 1 cut(s) 295
BstDEI CTNAG 2 cut(s) 52, 298
BstF5I GGATG 3 cut(s) 13, 163, 444
BstKTI GATC 1 cut(s) 51
BstMBI GATC 1 cut(s) 48
BstMWI GCNNNNNNNGC 3 cut(s) 251, 347, 409
BstNSI RCATGY 1 cut(s) 165
BstSFI CTRYAG 1 cut(s) 202
BstV1I GCAGC 2 cut(s) 19, 200
BstV2I GAAGAC 1 cut(s) 270
BsuRI GGCC 3 cut(s) 57, 110, 403
BtsCI GGATG 3 cut(s) 13, 163, 444
Cac8I GCNNGC 1 cut(s) 295
CaiI CAGNNNCTG 1 cut(s) 239
Cfr13I GGNCC 3 cut(s) 343, 367, 401
CviAII CATG 2 cut(s) 112, 162
DdeI CTNAG 2 cut(s) 52, 298
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
DraI TTTAAA 1 cut(s) 183
EaeI YGGCCR 1 cut(s) 108
Eco130I CCWWGG 1 cut(s) 219
Eco147I AGGCCT 1 cut(s) 57
Eco47I GGWCC 2 cut(s) 343, 367
Eco57I CTGAAG 1 cut(s) 111
Eco88I CYCGRG 2 cut(s) 418, 432
EcoO109I RGGNCCY 2 cut(s) 367, 401
EcoT14I CCWWGG 1 cut(s) 219
EcoT22I ATGCAT 1 cut(s) 163
ErhI CCWWGG 1 cut(s) 219
FaeI CATG 2 cut(s) 115, 165
FaiI YATR 5 cut(s) 37, 113, 155, 163, 381
FatI CATG 2 cut(s) 111, 161
FauI CCCGC 1 cut(s) 84
Fnu4HI GCNGC 2 cut(s) 33, 189
FokI GGATG 2 cut(s) 20, 170
Fsp4HI GCNGC 2 cut(s) 33, 189
GluI GCNGC 2 cut(s) 33, 189
GsaI CCCAGC 1 cut(s) 177
GsuI CTGGAG 1 cut(s) 356
HaeIII GGCC 3 cut(s) 57, 110, 403
Hin1II CATG 2 cut(s) 115, 165
HphI GGTGA 1 cut(s) 58
Hpy188I TCNGA 2 cut(s) 130, 301
Hpy188III TCNNGA 1 cut(s) 418
HpyAV CCTTC 1 cut(s) 414
HpyCH4V TGCA 5 cut(s) 35, 161, 254, 310, 442
HpyF10VI GCNNNNNNNGC 3 cut(s) 251, 347, 409
HpyF3I CTNAG 2 cut(s) 52, 298
Hsp92II CATG 2 cut(s) 115, 165
Kzo9I GATC 1 cut(s) 48
LmnI GCTCC 1 cut(s) 360
LpnPI CCDG 7 cut(s) 39, 159, 246, 264, 279, 384, 386
Lsp1109I GCAGC 2 cut(s) 19, 200
LweI GCATC 3 cut(s) 148, 226, 429
MaeIII GTNAC 2 cut(s) 97, 394
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MboII GAAGA 2 cut(s) 117, 270
MfeI CAATTG 1 cut(s) 311
MlsI TGGCCA 1 cut(s) 110
MluCI AATT 3 cut(s) 178, 209, 311
MluNI TGGCCA 1 cut(s) 110
MnlI CCTC 6 cut(s) 5, 68, 356, 380, 414, 428
Mox20I TGGCCA 1 cut(s) 110
Mph1103I ATGCAT 1 cut(s) 163
MscI TGGCCA 1 cut(s) 110
MseI TTAA 2 cut(s) 77, 182
MslI CAYNNNNRTG 1 cut(s) 355
Msp20I TGGCCA 1 cut(s) 110
MunI CAATTG 1 cut(s) 311
MwoI GCNNNNNNNGC 3 cut(s) 251, 347, 409
NdeII GATC 1 cut(s) 48
NlaIII CATG 2 cut(s) 115, 165
NmuCI GTSAC 1 cut(s) 394
NsiI ATGCAT 1 cut(s) 163
NspI RCATGY 1 cut(s) 165
PaeR7I CTCGAG 1 cut(s) 432
PceI AGGCCT 1 cut(s) 57
PkrI GCNGC 2 cut(s) 34, 190
PpuMI RGGWCCY 1 cut(s) 367
Psp5II RGGWCCY 1 cut(s) 367
PspFI CCCAGC 1 cut(s) 173
PspPI GGNCC 3 cut(s) 343, 367, 401
PspPPI RGGWCCY 1 cut(s) 367
PspXI VCTCGAGB 1 cut(s) 432
PstNI CAGNNNCTG 1 cut(s) 239
RseI CAYNNNNRTG 1 cut(s) 355
SaqAI TTAA 2 cut(s) 77, 182
SatI GCNGC 2 cut(s) 33, 189
Sau3AI GATC 1 cut(s) 48
Sau96I GGNCC 3 cut(s) 343, 367, 401
SetI ASST 4 cut(s) 175, 193, 295, 372
SfaNI GCATC 3 cut(s) 148, 226, 429
SfcI CTRYAG 1 cut(s) 202
Sfr274I CTCGAG 1 cut(s) 432
SinI GGWCC 2 cut(s) 343, 367
SlaI CTCGAG 1 cut(s) 432
SmiMI CAYNNNNRTG 1 cut(s) 355
SmlI CTYRAG 1 cut(s) 432
SmoI CTYRAG 1 cut(s) 432
Sse9I AATT 3 cut(s) 178, 209, 311
SseBI AGGCCT 1 cut(s) 57
SsiI CCGC 3 cut(s) 4, 91, 341
StuI AGGCCT 1 cut(s) 57
StyI CCWWGG 1 cut(s) 219
TaqI TCGA 1 cut(s) 433
TasI AATT 3 cut(s) 178, 209, 311
Tru1I TTAA 2 cut(s) 77, 182
Tru9I TTAA 2 cut(s) 77, 182
TseFI GTSAC 1 cut(s) 394
TseI GCWGC 2 cut(s) 32, 188
Tsp45I GTSAC 1 cut(s) 394
TspGWI ACGGA 1 cut(s) 54
VpaK11BI GGWCC 2 cut(s) 343, 367
XapI RAATTY 1 cut(s) 178
XceI RCATGY 1 cut(s) 165
XhoI CTCGAG 1 cut(s) 432
Zsp2I ATGCAT 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.