Rmu_sc0014119.1_g000001

Pentacotripeptide-repeat region of PRORP

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014119.1
Physical Location & Seq
Reverse (-)
116 .. 382
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014119.1_g000001.1.cds

Sequence Viewer

Length: 267 bp
atgagtaaaatgcgggatggaggggttagtcttgttgtggctgcatacggagtggtgatctcaggcctctgtaagaatggtcagttaaataaagcaatgcgggtcgttacagatttggccatgtgtggtttttcttcagataagatgttgttgatgaccattatggatgcatgtttcaaagctgggaatttaaaagcagcttcgggtttctacagagaattgttcgccaaggggtttgaaccagatgctgtggtgcttcagctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

9.4

Weight (kDa)

8.91

Isoelectric Point (pI)

29.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 13, 100
AcoI YGGCCR 1 cut(s) 117
AcsI RAATTY 1 cut(s) 187
AcuI CTGAAG 2 cut(s) 120, 242
AgsI TTSAA 2 cut(s) 178, 239
AluBI AGCT 3 cut(s) 182, 200, 262
AluI AGCT 3 cut(s) 182, 200, 262
AlwNI CAGNNNCTG 1 cut(s) 248
AoxI GGCC 2 cut(s) 64, 117
ApeKI GCWGC 2 cut(s) 41, 197
ApoI RAATTY 1 cut(s) 187
AsuHPI GGTGA 1 cut(s) 67
BalI TGGCCA 1 cut(s) 119
BbvI GCAGC 2 cut(s) 28, 209
BccI CCATC 1 cut(s) 11
BfmI CTRYAG 1 cut(s) 211
BisI GCNGC 2 cut(s) 42, 198
BlsI GCNGC 2 cut(s) 43, 199
BmsI GCATC 2 cut(s) 157, 235
BsaJI CCNNGG 1 cut(s) 228
Bse3DI GCAATG 1 cut(s) 102
BseDI CCNNGG 1 cut(s) 228
BseGI GGATG 2 cut(s) 22, 172
BseMI GCAATG 1 cut(s) 102
BseMII CTCAG 1 cut(s) 75
BseXI GCAGC 2 cut(s) 28, 209
BseYI CCCAGC 1 cut(s) 182
BshFI GGCC 2 cut(s) 66, 119
BsnI GGCC 2 cut(s) 66, 119
Bsp143I GATC 1 cut(s) 57
BspACI CCGC 2 cut(s) 13, 100
BspANI GGCC 2 cut(s) 66, 119
BspCNI CTCAG 1 cut(s) 74
BsrDI GCAATG 1 cut(s) 102
BssECI CCNNGG 1 cut(s) 228
BssMI GATC 1 cut(s) 57
BssT1I CCWWGG 1 cut(s) 228
BstDEI CTNAG 1 cut(s) 61
BstF5I GGATG 2 cut(s) 22, 172
BstKTI GATC 1 cut(s) 60
BstMBI GATC 1 cut(s) 57
BstNSI RCATGY 1 cut(s) 174
BstSFI CTRYAG 1 cut(s) 211
BstV1I GCAGC 2 cut(s) 28, 209
BsuRI GGCC 2 cut(s) 66, 119
BtsCI GGATG 2 cut(s) 22, 172
CaiI CAGNNNCTG 1 cut(s) 248
CviAII CATG 2 cut(s) 121, 171
CviJI RGCY 6 cut(s) 41, 66, 119, 182, 200, 262
CviKI_1 RGCY 6 cut(s) 41, 66, 119, 182, 200, 262
DdeI CTNAG 1 cut(s) 61
DpnI GATC 1 cut(s) 59
DpnII GATC 1 cut(s) 57
DraI TTTAAA 1 cut(s) 192
EaeI YGGCCR 1 cut(s) 117
Eco130I CCWWGG 1 cut(s) 228
Eco147I AGGCCT 1 cut(s) 66
Eco57I CTGAAG 2 cut(s) 120, 242
EcoT14I CCWWGG 1 cut(s) 228
EcoT22I ATGCAT 1 cut(s) 172
ErhI CCWWGG 1 cut(s) 228
FaeI CATG 2 cut(s) 124, 174
FaiI YATR 4 cut(s) 46, 122, 164, 172
FatI CATG 2 cut(s) 120, 170
FauI CCCGC 2 cut(s) 6, 93
Fnu4HI GCNGC 2 cut(s) 42, 198
FokI GGATG 2 cut(s) 29, 179
Fsp4HI GCNGC 2 cut(s) 42, 198
GluI GCNGC 2 cut(s) 42, 198
GsaI CCCAGC 1 cut(s) 186
HaeIII GGCC 2 cut(s) 66, 119
Hin1II CATG 2 cut(s) 124, 174
HphI GGTGA 1 cut(s) 67
Hpy188I TCNGA 1 cut(s) 139
HpyCH4V TGCA 2 cut(s) 44, 170
HpyF3I CTNAG 1 cut(s) 61
Hsp92II CATG 2 cut(s) 124, 174
Kzo9I GATC 1 cut(s) 57
LpnPI CCDG 3 cut(s) 48, 168, 255
Lsp1109I GCAGC 2 cut(s) 28, 209
LweI GCATC 2 cut(s) 157, 235
MaeIII GTNAC 1 cut(s) 106
MalI GATC 1 cut(s) 59
MboI GATC 1 cut(s) 57
MboII GAAGA 1 cut(s) 126
MlsI TGGCCA 1 cut(s) 119
MluCI AATT 2 cut(s) 187, 218
MluNI TGGCCA 1 cut(s) 119
MnlI CCTC 2 cut(s) 14, 77
Mox20I TGGCCA 1 cut(s) 119
Mph1103I ATGCAT 1 cut(s) 172
MscI TGGCCA 1 cut(s) 119
MseI TTAA 2 cut(s) 86, 191
Msp20I TGGCCA 1 cut(s) 119
NdeII GATC 1 cut(s) 57
NlaIII CATG 2 cut(s) 124, 174
NsiI ATGCAT 1 cut(s) 172
NspI RCATGY 1 cut(s) 174
PceI AGGCCT 1 cut(s) 66
PkrI GCNGC 2 cut(s) 43, 199
PspFI CCCAGC 1 cut(s) 182
PstNI CAGNNNCTG 1 cut(s) 248
SaqAI TTAA 2 cut(s) 86, 191
SatI GCNGC 2 cut(s) 42, 198
Sau3AI GATC 1 cut(s) 57
SetI ASST 3 cut(s) 184, 202, 264
SfaNI GCATC 2 cut(s) 157, 235
SfcI CTRYAG 1 cut(s) 211
Sse9I AATT 2 cut(s) 187, 218
SseBI AGGCCT 1 cut(s) 66
SsiI CCGC 2 cut(s) 13, 100
StuI AGGCCT 1 cut(s) 66
StyI CCWWGG 1 cut(s) 228
TasI AATT 2 cut(s) 187, 218
Tru1I TTAA 2 cut(s) 86, 191
Tru9I TTAA 2 cut(s) 86, 191
TseI GCWGC 2 cut(s) 41, 197
TspGWI ACGGA 1 cut(s) 63
XapI RAATTY 1 cut(s) 187
XceI RCATGY 1 cut(s) 174
Zsp2I ATGCAT 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.