RchiOBHm_Chr3g0490381

ribonuclease H protein At1g65750

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
37013713 .. 37013989
277 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGGAAGCTGTAAGCTTCTGGTGCTTTTCTTGCAAGTCCTTTCACAAATTTCTGATTGGTGATAGACTGGAACAAAAAATTTCTCCAGCAAGTCTTACCTGGAAACATAAAGTTCCAGCCAAGGTCAAGGTTTCACGCTGGTTGGTCCACTCATGGGAGGACGAATATTTGCGATATGTTTCAATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.45

Weight (kDa)

9.34

Isoelectric Point (pI)

52.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 47, 78
AfiI CCNNNNNNNGG 1 cut(s) 154
AgsI TTSAA 1 cut(s) 183
AjnI CCWGG 1 cut(s) 98
AluBI AGCT 2 cut(s) 8, 15
AluI AGCT 2 cut(s) 8, 15
ApoI RAATTY 2 cut(s) 47, 78
AspS9I GGNCC 1 cut(s) 145
AsuHPI GGTGA 1 cut(s) 71
AvaII GGWCC 1 cut(s) 145
BciT130I CCWGG 1 cut(s) 100
Bme1390I CCNGG 1 cut(s) 100
Bme18I GGWCC 1 cut(s) 145
BmgT120I GGNCC 1 cut(s) 145
BmrFI CCNGG 1 cut(s) 100
BpmI CTGGAG 1 cut(s) 69
BsaJI CCNNGG 1 cut(s) 120
Bsc4I CCNNNNNNNGG 1 cut(s) 154
Bse1I ACTGG 1 cut(s) 72
BseBI CCWGG 1 cut(s) 100
BseDI CCNNGG 1 cut(s) 120
BseLI CCNNNNNNNGG 1 cut(s) 154
BseNI ACTGG 1 cut(s) 72
BslI CCNNNNNNNGG 1 cut(s) 154
BsrI ACTGG 1 cut(s) 72
BssECI CCNNGG 1 cut(s) 120
BssT1I CCWWGG 1 cut(s) 120
Bst2UI CCWGG 1 cut(s) 100
BstMWI GCNNNNNNNGC 2 cut(s) 21, 30
BstNI CCWGG 1 cut(s) 100
BstSCI CCNGG 1 cut(s) 98
Cfr13I GGNCC 1 cut(s) 145
CviAII CATG 1 cut(s) 153
CviJI RGCY 3 cut(s) 8, 15, 119
CviKI_1 RGCY 3 cut(s) 8, 15, 119
Eco130I CCWWGG 1 cut(s) 120
Eco47I GGWCC 1 cut(s) 145
EcoRII CCWGG 1 cut(s) 98
EcoT14I CCWWGG 1 cut(s) 120
ErhI CCWWGG 1 cut(s) 120
FaeI CATG 1 cut(s) 156
FaiI YATR 3 cut(s) 108, 154, 177
FatI CATG 1 cut(s) 152
GsuI CTGGAG 1 cut(s) 69
Hin1II CATG 1 cut(s) 156
HindIII AAGCTT 1 cut(s) 13
HphI GGTGA 1 cut(s) 71
Hpy166II GTNNAC 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 54
Hpy8I GTNNAC 1 cut(s) 148
HpyCH4V TGCA 1 cut(s) 33
HpyF10VI GCNNNNNNNGC 2 cut(s) 21, 30
Hsp92II CATG 1 cut(s) 156
LpnPI CCDG 7 cut(s) 4, 53, 85, 99, 112, 124, 129
MluCI AATT 2 cut(s) 47, 78
MnlI CCTC 1 cut(s) 151
MspR9I CCNGG 1 cut(s) 100
MvaI CCWGG 1 cut(s) 100
MwoI GCNNNNNNNGC 2 cut(s) 21, 30
NlaIII CATG 1 cut(s) 156
Psp6I CCWGG 1 cut(s) 98
PspGI CCWGG 1 cut(s) 98
PspPI GGNCC 1 cut(s) 145
Sau96I GGNCC 1 cut(s) 145
ScrFI CCNGG 1 cut(s) 100
SetI ASST 5 cut(s) 10, 17, 101, 126, 132
SinI GGWCC 1 cut(s) 145
Sse9I AATT 2 cut(s) 47, 78
SspI AATATT 1 cut(s) 167
StyD4I CCNGG 1 cut(s) 98
StyI CCWWGG 1 cut(s) 120
TasI AATT 2 cut(s) 47, 78
VpaK11BI GGWCC 1 cut(s) 145
XapI RAATTY 2 cut(s) 47, 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.