Rmu_sc0003177.1_g000032

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003177.1
OG0014880
Physical Location & Seq
Forward (+)
131861 .. 132235
375 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003177.1_g000032.1.cds

Sequence Viewer

Length: 375 bp
atggctttgatcaaggcaaacatagcaggaatgccaaatcatgttatatcttactttaaatgttcacccaaattcaccaatgttatagacaaggaaaacaagaattttctatggggttcaagttctagaaccccacctgttgcttggaaccaagtttgcactcctaaaaccattggtggcttaagaattaggccaactgctttctttaataatgctgctataggcaaattggcttggaagattatcactgaccctaacacctggtgggttcaaatcatgaaaagaaaatatttgaaaagagattcctcttccaagctaaaaagaagcagtctgcctcttttgcttggaaagaagtgctggattccaagagtctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

124

Amino Acids

14.15

Weight (kDa)

10.63

Isoelectric Point (pI)

46.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 71, 103
AdeI CACNNNGTG 1 cut(s) 264
AflII CTTAAG 1 cut(s) 181
AgsI TTSAA 3 cut(s) 120, 272, 295
AjnI CCWGG 1 cut(s) 260
AluBI AGCT 1 cut(s) 316
AluI AGCT 1 cut(s) 316
AoxI GGCC 1 cut(s) 191
ApeKI GCWGC 1 cut(s) 215
ApoI RAATTY 2 cut(s) 71, 103
AsuHPI GGTGA 2 cut(s) 57, 67
BbvI GCAGC 1 cut(s) 202
BciT130I CCWGG 1 cut(s) 262
BclI TGATCA 1 cut(s) 9
BfaI CTAG 1 cut(s) 126
BfmI CTRYAG 1 cut(s) 219
BfrI CTTAAG 1 cut(s) 181
BisI GCNGC 1 cut(s) 216
BlsI GCNGC 1 cut(s) 217
Bme1390I CCNGG 1 cut(s) 262
BmiI GGNNCC 1 cut(s) 149
BmrFI CCNGG 1 cut(s) 262
BseBI CCWGG 1 cut(s) 262
BseXI GCAGC 1 cut(s) 202
BshFI GGCC 1 cut(s) 193
BsmI GAATGC 1 cut(s) 36
BsnI GGCC 1 cut(s) 193
Bsp143I GATC 1 cut(s) 9
BspANI GGCC 1 cut(s) 193
BspHI TCATGA 1 cut(s) 276
BspLI GGNNCC 1 cut(s) 149
BspTI CTTAAG 1 cut(s) 181
BssMI GATC 1 cut(s) 9
Bst2UI CCWGG 1 cut(s) 262
Bst6I CTCTTC 1 cut(s) 313
BstAFI CTTAAG 1 cut(s) 181
BstKTI GATC 1 cut(s) 12
BstMBI GATC 1 cut(s) 9
BstMWI GCNNNNNNNGC 2 cut(s) 23, 340
BstNI CCWGG 1 cut(s) 262
BstSCI CCNGG 1 cut(s) 260
BstSFI CTRYAG 1 cut(s) 219
BstV1I GCAGC 1 cut(s) 202
BsuRI GGCC 1 cut(s) 193
BtsIMutI CAGTG 1 cut(s) 246
CciI TCATGA 1 cut(s) 276
CsiI ACCWGGT 1 cut(s) 260
CviAII CATG 2 cut(s) 41, 277
CviJI RGCY 5 cut(s) 5, 180, 193, 233, 316
CviKI_1 RGCY 5 cut(s) 5, 180, 193, 233, 316
DpnI GATC 1 cut(s) 11
DpnII GATC 1 cut(s) 9
DraI TTTAAA 1 cut(s) 58
DraIII CACNNNGTG 1 cut(s) 264
Eam1104I CTCTTC 1 cut(s) 313
EarI CTCTTC 1 cut(s) 313
EcoRII CCWGG 1 cut(s) 260
FaeI CATG 2 cut(s) 44, 280
FaiI YATR 7 cut(s) 23, 42, 47, 86, 112, 221, 278
FatI CATG 2 cut(s) 40, 276
FbaI TGATCA 1 cut(s) 9
Fnu4HI GCNGC 1 cut(s) 216
Fsp4HI GCNGC 1 cut(s) 216
FspBI CTAG 1 cut(s) 126
GluI GCNGC 1 cut(s) 216
HaeIII GGCC 1 cut(s) 193
Hin1II CATG 2 cut(s) 44, 280
HinfI GANTC 3 cut(s) 302, 361, 369
HphI GGTGA 2 cut(s) 57, 67
Hpy166II GTNNAC 1 cut(s) 65
Hpy188III TCNNGA 2 cut(s) 126, 277
Hpy8I GTNNAC 1 cut(s) 65
HpyCH4V TGCA 1 cut(s) 159
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 340
Hsp92II CATG 2 cut(s) 44, 280
Ksp22I TGATCA 1 cut(s) 9
Kzo9I GATC 1 cut(s) 9
LpnPI CCDG 5 cut(s) 12, 150, 247, 274, 343
Lsp1109I GCAGC 1 cut(s) 202
MabI ACCWGGT 1 cut(s) 260
MaeI CTAG 1 cut(s) 126
MalI GATC 1 cut(s) 11
MboI GATC 1 cut(s) 9
MboII GAAGA 2 cut(s) 250, 300
MluCI AATT 4 cut(s) 71, 103, 186, 227
MnlI CCTC 2 cut(s) 316, 345
MseI TTAA 3 cut(s) 57, 182, 207
MspCI CTTAAG 1 cut(s) 181
MspR9I CCNGG 1 cut(s) 262
Mva1269I GAATGC 1 cut(s) 36
MvaI CCWGG 1 cut(s) 262
MwoI GCNNNNNNNGC 2 cut(s) 23, 340
NdeII GATC 1 cut(s) 9
NlaIII CATG 2 cut(s) 44, 280
NlaIV GGNNCC 1 cut(s) 149
PagI TCATGA 1 cut(s) 276
PctI GAATGC 1 cut(s) 36
PfeI GAWTC 2 cut(s) 302, 361
PkrI GCNGC 1 cut(s) 217
Psp6I CCWGG 1 cut(s) 260
PspGI CCWGG 1 cut(s) 260
PspN4I GGNNCC 1 cut(s) 149
SaqAI TTAA 3 cut(s) 57, 182, 207
SatI GCNGC 1 cut(s) 216
Sau3AI GATC 1 cut(s) 9
ScrFI CCNGG 1 cut(s) 262
SetI ASST 3 cut(s) 139, 263, 318
SexAI ACCWGGT 1 cut(s) 260
SfcI CTRYAG 1 cut(s) 219
SmlI CTYRAG 1 cut(s) 181
SmoI CTYRAG 1 cut(s) 181
Sse9I AATT 4 cut(s) 71, 103, 186, 227
SspI AATATT 1 cut(s) 290
SspMI CTAG 1 cut(s) 126
StyD4I CCNGG 1 cut(s) 260
TasI AATT 4 cut(s) 71, 103, 186, 227
TfiI GAWTC 2 cut(s) 302, 361
Tru1I TTAA 3 cut(s) 57, 182, 207
Tru9I TTAA 3 cut(s) 57, 182, 207
TscAI CASTG 1 cut(s) 253
TseI GCWGC 1 cut(s) 215
TspDTI ATGAA 1 cut(s) 293
TspRI CASTG 1 cut(s) 253
Vha464I CTTAAG 1 cut(s) 181
XapI RAATTY 2 cut(s) 71, 103
XbaI TCTAGA 1 cut(s) 125
XcmI CCANNNNNNNNNTGG 1 cut(s) 141
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.