Rmu_sc0007121.1_g000017

ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007121.1
Physical Location & Seq
Forward (+)
62919 .. 63179
261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007121.1_g000017.1.cds

Sequence Viewer

Length: 261 bp
atggccttgatcaaggcaaacatagcaggaatgccaaatcatgttatgtcttactttaaatgttcaccaaaattcaccaatgttatggacaaggaaaacaagaattttctatggggttcaagttctagaaccccacctgttgcttggaaccaagtttgcactcctaaagccattggtggcttaagaattaggccagctgctttctttaataatgctgctataggcaaattggcttggaagattatcactgaccctaactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.51

Weight (kDa)

10.12

Isoelectric Point (pI)

48.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 71, 103
AflII CTTAAG 1 cut(s) 181
AgsI TTSAA 1 cut(s) 120
AluBI AGCT 1 cut(s) 197
AluI AGCT 1 cut(s) 197
AoxI GGCC 2 cut(s) 3, 191
ApeKI GCWGC 2 cut(s) 197, 215
ApoI RAATTY 2 cut(s) 71, 103
AsuHPI GGTGA 2 cut(s) 57, 67
BbvI GCAGC 2 cut(s) 184, 202
BclI TGATCA 1 cut(s) 9
BfaI CTAG 1 cut(s) 126
BfmI CTRYAG 1 cut(s) 219
BfrI CTTAAG 1 cut(s) 181
BisI GCNGC 2 cut(s) 198, 216
BlsI GCNGC 2 cut(s) 199, 217
BmiI GGNNCC 1 cut(s) 149
BseXI GCAGC 2 cut(s) 184, 202
BshFI GGCC 2 cut(s) 5, 193
BsmI GAATGC 1 cut(s) 36
BsnI GGCC 2 cut(s) 5, 193
Bsp143I GATC 1 cut(s) 9
BspANI GGCC 2 cut(s) 5, 193
BspLI GGNNCC 1 cut(s) 149
BspTI CTTAAG 1 cut(s) 181
BssMI GATC 1 cut(s) 9
BstAFI CTTAAG 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 195
BstKTI GATC 1 cut(s) 12
BstMBI GATC 1 cut(s) 9
BstMWI GCNNNNNNNGC 1 cut(s) 23
BstSFI CTRYAG 1 cut(s) 219
BstV1I GCAGC 2 cut(s) 184, 202
BstXI CCANNNNNNTGG 1 cut(s) 85
BsuRI GGCC 2 cut(s) 5, 193
BtsIMutI CAGTG 1 cut(s) 246
Cac8I GCNNGC 1 cut(s) 195
CviAII CATG 1 cut(s) 41
CviJI RGCY 6 cut(s) 5, 170, 180, 193, 197, 233
CviKI_1 RGCY 6 cut(s) 5, 170, 180, 193, 197, 233
DpnI GATC 1 cut(s) 11
DpnII GATC 1 cut(s) 9
DraI TTTAAA 1 cut(s) 58
FaeI CATG 1 cut(s) 44
FaiI YATR 6 cut(s) 23, 42, 47, 86, 112, 221
FatI CATG 1 cut(s) 40
FbaI TGATCA 1 cut(s) 9
Fnu4HI GCNGC 2 cut(s) 198, 216
Fsp4HI GCNGC 2 cut(s) 198, 216
FspBI CTAG 1 cut(s) 126
GluI GCNGC 2 cut(s) 198, 216
HaeIII GGCC 2 cut(s) 5, 193
Hin1II CATG 1 cut(s) 44
HphI GGTGA 2 cut(s) 57, 67
Hpy166II GTNNAC 1 cut(s) 65
Hpy188III TCNNGA 1 cut(s) 126
Hpy8I GTNNAC 1 cut(s) 65
HpyCH4V TGCA 1 cut(s) 159
HpyF10VI GCNNNNNNNGC 1 cut(s) 23
Hsp92II CATG 1 cut(s) 44
Ksp22I TGATCA 1 cut(s) 9
Kzo9I GATC 1 cut(s) 9
LpnPI CCDG 3 cut(s) 12, 150, 207
Lsp1109I GCAGC 2 cut(s) 184, 202
MaeI CTAG 1 cut(s) 126
MalI GATC 1 cut(s) 11
MboI GATC 1 cut(s) 9
MboII GAAGA 1 cut(s) 250
MluCI AATT 4 cut(s) 71, 103, 186, 227
MseI TTAA 3 cut(s) 57, 182, 207
MspA1I CMGCKG 1 cut(s) 197
MspCI CTTAAG 1 cut(s) 181
Mva1269I GAATGC 1 cut(s) 36
MwoI GCNNNNNNNGC 1 cut(s) 23
NdeII GATC 1 cut(s) 9
NlaIII CATG 1 cut(s) 44
NlaIV GGNNCC 1 cut(s) 149
PctI GAATGC 1 cut(s) 36
PkrI GCNGC 2 cut(s) 199, 217
PspN4I GGNNCC 1 cut(s) 149
PvuII CAGCTG 1 cut(s) 197
SaqAI TTAA 3 cut(s) 57, 182, 207
SatI GCNGC 2 cut(s) 198, 216
Sau3AI GATC 1 cut(s) 9
SetI ASST 2 cut(s) 139, 199
SfcI CTRYAG 1 cut(s) 219
SmlI CTYRAG 1 cut(s) 181
SmoI CTYRAG 1 cut(s) 181
Sse9I AATT 4 cut(s) 71, 103, 186, 227
SspMI CTAG 1 cut(s) 126
TasI AATT 4 cut(s) 71, 103, 186, 227
Tru1I TTAA 3 cut(s) 57, 182, 207
Tru9I TTAA 3 cut(s) 57, 182, 207
TscAI CASTG 1 cut(s) 253
TseI GCWGC 2 cut(s) 197, 215
TspRI CASTG 1 cut(s) 253
Vha464I CTTAAG 1 cut(s) 181
XapI RAATTY 2 cut(s) 71, 103
XbaI TCTAGA 1 cut(s) 125
XcmI CCANNNNNNNNNTGG 1 cut(s) 141
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.